Practice MCQsBuild a paperTopical banksYearly papersBuild a paperPricing
Topical›Biology 9700›Nucleic acids and protein synthesis›Protein synthesis›Paper 1

Protein synthesis — Paper 1 · A Level Biology 9700

6.2· 206 questions · 206 marks · 247 min · 2004–2025· Multiple choice

Every Cambridge A Level Biology Paper 1 question on protein synthesis, laid out as 58 A4 pages with the mark scheme below. Nothing is left out. Free to read, no account.

QuestionsMark scheme
Different topic or paper

Questions58 pages

Question 1: When not involved in protein synthesis, ribosomes exist as separate subunits. What do these subunits consist of? A mRNA and lipid B mRNA an…Question 2: How many different polypeptides, each consisting of r amino acids, can be made if the number of different amino acids available is n ? n r …Question 3: In the DNA sequence for sickle cell anaemia, adenine replaces thymine in a CTT triplet, forming the triplet CAT. During synthesis of the si…Question 4: In transcription, what is transcribed and what is the product? transcribed product A DNA mRNA B DNA polypeptide C mRNA DNA D mRNA polypepti…Question 5: The table shows mRNA triplets and their corresponding amino acids. mRNA triplet GCA GCG GAA GAG AAA AAG amino acid ala ala glu glu lys lys …Question 6: In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides is transcribed and translated. What is the t…1 / 58
Question 7: DNA from a chromosome is analysed and 20 % of its bases are found to be cytosine. Which percentage of uracil molecules will be found in mRN…Question 8: What terminates the formation of a polypeptide chain during protein synthesis in cells? A when a ‘stop’ codon is reached on the mRNA molecu…Question 9: Which type of molecule is the end product of translation? A amino acid B DNA C mRNA D polypeptideQuestion 10: An unidentified single-stranded molecule was described as having the following features. • complementary base pairing along some of its len…2 / 58
Question 11: Some antibacterial drugs can affect the synthesis of proteins. antimicrobial rifampicin streptomycin tetracycline drug mode of binds to RNA…Question 12: The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide. The diagram shows a strand of DNA which codes for four…Question 13: Part of the amino acid sequences in normal and sickle cell haemoglobin are shown. normal haemoglobin sickle cell haemoglobin thr-pro-glu-gl…3 / 58
Question 14: Haemoglobin is a globular protein consisting of four polypeptide chains – 2 alpha chains and 2 beta chains. In normal individuals, in the D…Question 15: What is the function of the enzyme RNA polymerase? A to form a polypeptide using mRNA as a template B to form a strand of DNA using mRNA as…Question 16: The table gives the tRNA anticodons for four amino acids. amino acid anticodon (tRNA) asparagine UUA glutamic acid CUU proline GGA threonin…Question 17: The following statements describe events that take place during DNA replication and transcription. Which statement is not correct? DNA tran…4 / 58
Question 18: A peptide consists of ten amino acids of four different kinds. What is the theoretical minimum number of tRNA molecules required to transla…Question 19: What is the minimum number of base substitutions required to change the nucleotide sequence of the HbA (normal) allele to the HbS (sickle c…Question 20: In a DNA molecule, the base sequence AGT codes for the amino acid serine. What is the base sequence of the anti-codon on the tRNA to which …Question 21: In a DNA molecule, the base sequence AGT codes for the amino acid serine. What is the base sequence of the anti-codon on the tRNA to which …Question 22: In a DNA molecule, the base sequence AGT codes for the amino acid serine. What is the base sequence of the anti-codon on the tRNA to which …Question 23: Which row shows the correct combination? triplet code codon anticodon A DNA mRNA tRNA B DNA tRNA mRNA C mRNA DNA tRNA D tRNA mRNA DNAQuestion 24: The following events occur during transcription. 1 Bonds break between complementary bases. 2 Bonds form between complementary bases. 3 Sug…5 / 58
Question 25: The table shows the tRNA anticodons for four amino acids. amino acid anticodon (tRNA) asparagine UUA glutamic acid CUU proline GGA threonin…Question 26: What does the enzyme RNA polymerase synthesise? A a polypeptide from an mRNA template B a strand of DNA from an mRNA template C mRNA from a…Question 27: The following events occur during transcription. 1 Bonds break between complementary bases. 2 Bonds form between complementary bases. 3 Sug…Question 28: In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides coding for a specific polypeptide is transcr…6 / 58
Question 29: Which molecule has its synthesis directly controlled by DNA? A amylase B cholesterol C glycogen D phospholipidQuestion 30: Which molecule has its synthesis directly controlled by DNA? A amylase B cholesterol C glycogen D phospholipidQuestion 31: In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides coding for a specific polypeptide is transcr…Question 32: Which statement describes a process that occurs during protein synthesis? A Transcription is the linking together of a tRNA molecule and a …7 / 58
Question 33: A length of double-stranded DNA contains 120 nucleotides and codes for polypeptide X. What is the maximum length of polypeptide X? A 20 ami…Question 34: What does the process of transcription require? A ATP, DNA and free nucleotide bases B DNA, mRNA and RNA polymerase C mRNA, ribosomes and R…Question 35: A peptide consists of ten amino acids of four different kinds. What is the theoretical minimum number of different tRNA molecules required …Question 36: Which statements about tRNA structure are correct? 1 There is a binding site for the attachment of a specific amino acid, as well as a diff…Question 37: A length of double-stranded DNA contains 120 nucleotides and codes for polypeptide X. What is the maximum length of polypeptide X? A 20 ami…8 / 58
Question 38: Which statement describes a process that occurs during protein synthesis? A Transcription is the linking together of a tRNA molecule and a …Question 39: What does the process of translation require? A DNA, free nucleotide bases and mRNA B DNA, mRNA and RNA polymerase C mRNA, ribosomes and RN…Question 40: Which features of DNA enable it to meet these requirements as a molecule of inheritance? requirement of DNA molecule ability to remain abil…Question 41: Which row in the table correctly shows situations in which both DNA and RNA are both involved? replication | transcription | translation …9 / 58
Question 42: The diagram shows the stages in the production of a polypeptide. DNA nucleotide sequence template strand T A C G A C A A T C G C mRNA seque…Question 43: The sequence of nucleotides in DNA in a gene that controls the synthesis of a protein is arranged in triplets, each coding for specific ami…Question 44: Enzymes are ……1…… proteins, made up of polypeptides. A gene is a sequence of ……2……, which are parts of a ……3…… molecule coding for a polype…10 / 58
Question 45: Which process does not occur during the formation of messenger RNA? A condensation B polymerisation C replication D transcriptionQuestion 46: Which type of molecule is always the end product of transcription? A amino acid B functional protein C mRNA D polypeptideQuestion 47: The table gives tRNA anticodons for four amino acids. amino acid tRNA anticodon asparagine UUA glutamic acid CUU proline GGA threonine UGG …Question 48: Which type of molecule is the end product of translation? A amino acid B mRNA C polypeptide D tRNA11 / 58
Question 49: A polypeptide molecule contains the amino acid sequence: glycine – leucine – lysine – valine. The table shows DNA codes for these amino aci…Question 50: One gene provides the code for the production of which molecule? A amino acid B DNA C nucleotide D polypeptideQuestion 51: A polypeptide has the amino acid sequence glycine – arginine – lysine – serine. The table gives possible tRNA anticodons for each amino aci…12 / 58
Question 52: A piece of mammalian tissue was homogenised and centrifuged. The biochemical activity of four subcellular fractions was investigated. Which…Question 53: The following statements describe events that take place during DNA replication and transcription. Which row is not correct? DNA transcript…Question 54: Which statements about complementary base pairing are correct? 1 Purines and pyrimidines are different sizes. 2 It occurs during translatio…Question 55: What is the minimum number of base substitutions required to change the nucleotide sequence of the HbA (normal) allele to the HbS (sickle c…13 / 58
Question 56: What explains why cells with no nucleoli die? A They do not have centrioles and cannot divide. B They do not have mitochondria and cannot r…Question 57: Which statements about complementary base pairing are correct? 1 It occurs during translation. 2 Purines and pyrimidines are the same size.…Question 58: Part of the amino acid sequences in normal and sickle cell haemoglobin are shown. normal haemoglobin sickle cell haemoglobin thr-pro-glu-gl…Question 59: What is the correct sequence for the processes involved in the formation of an enzyme in a cell? A transcription → condensation → translati…Question 60: What terminates the formation of a polypeptide chain during protein synthesis in cells? A when a ‘stop’ codon is reached on the mRNA molecu…14 / 58
Question 61: The growth of crop plants is often limited by the availability of nitrogen in the soil. The graph shows the results of an investigation int…Question 62: Some antibiotics work by binding to ribosomes and preventing protein synthesis. Which statement explains why these antibiotics kill bacteri…Question 63: Which statements about tRNA are correct? 1 contains base pairing 2 contains hydrogen bonds 3 is single stranded A 1, 2 and 3 B 1 and 2 only…Question 64: Which sequence shows some of the stages in the production and secretion of an enzyme? A Golgi apparatus → ribosome → rough endoplasmic …15 / 58
Question 65: Which molecules are involved in transcription and which molecules are involved in translation? transcription translation A DNA and mRNA mRN…Question 66: Which row shows two pairs of nucleotides formed during transcription? first base pair transcribed second base pair transcribed number of nu…Question 67: What is needed to transcribe DNA? A DNA ligase B DNA polymerase C ribosomes D RNA polymeraseQuestion 68: In a ribosome, which bond holds together two adjacent amino acids? A disulfide B hydrogen C ionic D peptideQuestion 69: Ribosomes exist as separate subunits that bind together during protein synthesis. What do these subunits consist of? A mRNA and protein B m…16 / 58
Question 70: Which row shows two pairs of nucleotides formed when mRNA is translated? first base pair translated second base pair translated number of n…Question 71: Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram sh…Question 72: The statements describe the features of some nucleic acids. 1 carry an amino acid to a ribosome 2 carry a genetic code sequence out of the …Question 73: The antibiotic chloramphenicol prevents prokayotes from reproducing by inhibiting the enzyme which catalyses the formation of peptide bonds…17 / 58
Question 74: What occurs during DNA replication and transcription and translation? 1 ATP provides energy. 2 Condensation reactions occur to form a polym…Question 75: Ricin is a toxic protein which inactivates ribosomes. Which effect will this have on protein synthesis? A Amino acids will be unable to bin…Question 76: Which statements describe how a gene mutation can lead to the production of a non-functional protein? 1 During transcription an incorrect n…Question 77: Some antibiotics kill prokaryotes by binding to RNA polymerase. What effect will this have on protein synthesis? A Codons on mRNA will be u…18 / 58
Question 78: The electron micrograph shows part of a eukaryotic cell. Which of the labelled organelles is a site of protein synthesis? A B C DQuestion 79: One gene provides the code for the production of which type of molecule? A amino acid B DNA C nucleotide D polypeptideQuestion 80: The table shows the mode of action of two antibacterial drugs that can affect the synthesis of proteins. antibacterial rifampicin streptomy…19 / 58
Question 81: The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. CGCCGCACGCGC The table shows the amino acids c…Question 82: The statements describe the features of some nucleic acids. 1 carry an amino acid to a ribosome 2 carry a genetic code sequence out of the …Question 83: Which statements about complementary base pairing are correct? 1 Cytosine forms three hydrogen bonds with guanine. 2 Purines and pyrimidine…20 / 58
Question 84: Which statements about tRNA are correct? 1 It contains base pairing. 2 It contains hydrogen bonds. 3 It contains uracil. 4 It is single str…Question 85: The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. TTCTTCCCGTTC The table shows the amino acids c…Question 86: Which types of RNA are found in both prokaryotic and eukaryotic cells? mRNA rRNA tRNA v v v key /¥ = present X = absent 0 OD D> ~ « & a…Question 87: Which processes occur in bone marrow cells that are in a mitotic cell cycle? 1 phosphate groups bind to ADP molecules to form ATP 2 bonds f…21 / 58
Question 88: The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. CGGGCCCCGCGG The table shows the amino acids c…Question 89: When a gene mutation occurs, which of the following may be altered, resulting in the production of a non-functional protein? 1 amino acid s…22 / 58
Question 90: The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. GCAGCATGCGCG The table shows the amino acids c…Question 91: The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. GCGCGCGGCCGC The table shows the amino acids c…23 / 58
Question 92: The following events occur during transcription. 1 Bonds break between complementary bases. 2 Bonds form between complementary bases. 3 Sug…Question 93: Rifampicin is an antibiotic used to treat tuberculosis. It works by inhibiting RNA polymerase in bacteria. Which of these processes will be…Question 94: The diagram shows the stages in the production of part of a polypeptide. DNA nucleotide sequence template strand T A C G A C A A T C G C mR…Question 95: Some secretory cells synthesise and release glycoproteins. What is the correct order of the sequence of events as they occur in the secreto…24 / 58
Question 96: Which statements about tRNA are correct? 1 contains base pairing 2 contains hydrogen bonds 3 is single stranded A 1, 2 and 3 B 1 and 2 only…Question 97: Different tissues in a plant were supplied with a radioactively labelled substance to identify which tissues were actively synthesising mRN…Question 98: Electron micrographs may show large numbers of ribosomes forming chains along mRNA molecules. What is the advantage of this arrangement, co…Question 99: Which statement is correct? A During transcription, mRNA is synthesised from DNA nucleotides to have the same sequence of nucleotides as th…25 / 58
Question 100: The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. GCGCGCGGCGCG The table shows the amino acids c…Question 101: A cell was supplied with cytosine labelled with radioactive carbon. In which cell structure would radioactivity be detected first? A endopl…Question 102: Rifampicin is an antibiotic used to treat tuberculosis. It works by inhibiting RNA polymerase in bacteria. Which of these processes are pre…26 / 58
Question 103: The table shows three anticodons for different amino acids. amino acid anticodon alanine CGU histidine GUA serine UCA Which DNA triplet on …Question 104: Radioactively-labelled nucleotides are introduced into a cell. 1 2 3 4 In which cell structures will the radioactivity first become concent…Question 105: Which is the correct DNA triplet on the original DNA template that codes for the amino acid histidine (His)? amino acid anticodon Ala CGU H…Question 106: Which statements about tRNA are correct? 1 Hydrogen bonds between bases temporarily hold tRNA against mRNA. 2 The base sequences in the tRN…27 / 58
Question 107: What occurs during each of DNA replication and transcription and translation? 1 ATP provides energy. 2 Condensation reactions occur to form…Question 108: Part of a sequence of DNA from a person with a genetic disease is: TAGTAACCACAAAGG The corresponding sequence of DNA from a person without …Question 109: Some antibiotics work by binding to ribosomes. Which statement explains why these antibiotics kill bacteria cells but do not kill most huma…Question 110: Which statements about the primary structure of a protein are correct? 1 It may be branched. 2 It is determined by the sequence of DNA base…Question 111: Following translation, the alpha polypeptide chain of haemoglobin, α-globin, undergoes modification. During this modification, the first am…28 / 58
Question 112: A length of double-stranded DNA contains 120 nucleotides and codes for a section of a polypeptide. What is the maximum length of this secti…Question 113: Ribosomes exist as separate subunits that are bound together during protein synthesis. What do these subunits consist of? A mRNA and protei…Question 114: Rifampicin is an antibiotic used to treat tuberculosis (TB). It works by inhibiting RNA polymerase in bacteria. Which processes are directl…Question 115: In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides coding for a specific polypeptide is transcr…Question 116: Which statements about tRNA are correct? 1 Hydrogen bonds between bases temporarily hold tRNA against mRNA. 2 The base sequences in the tRN…29 / 58
Question 117: Which statements about complementary base pairing are correct? 1 It allows translation to occur. 2 Purines and pyrimidines are the same siz…Question 118: The diagram shows part of the DNA sequence of a gene and a mutated sequence of the same gene. normal DNA sequence ... CCG GAT TAT TGC GAG A…30 / 58
Question 119: The table shows the DNA triplet codes for some amino acids. amino acid DNA triplet code amino acid DNA triplet code arginine GCA glycine CC…Question 120: Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram sh…Question 121: Which types of RNA are present in prokaryotic cells and in eukaryotic cells? mRNA rRNA tRNA v v v key v¥ = present 0 0O WwW > v v x x …31 / 58
Question 122: The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide. The diagram shows a strand of DNA which codes for four…Question 123: Three proteins that have a quaternary structure are listed. • Type IX collagen is formed from three different polymers. • The main form of …Question 124: What is the maximum number of codon-anticodon interactions within one ribosome? A 2 B 3 C 4 D 6Question 125: Which statements about tRNA structure are correct? 1 There is a binding site for the attachment of a specific amino acid and a different bi…32 / 58
Question 126: The table shows the tRNA anticodons for four amino acids. amino acid tRNA anticodons asparagine UUA, UUG glutamic acid CUU, CUC proline GGA…Question 127: Part of the nucleotide sequence of an mRNA molecule is shown, with spaces between the codons. CAG UAC AGC AAU CUA UAA The translation of th…33 / 58
Question 128: The sequence of bases in mRNA for the first eight amino acids in the β-polypeptide of adult haemoglobin is: GUG–CAC–CUG–ACU–CCU–GAG–GAG–AAG…Question 129: Some antibiotics kill prokaryotes by binding to RNA polymerase. What effect will this have on protein synthesis? A Codons on mRNA will be u…Question 130: A molecule of transfer RNA (tRNA) has the anticodon sequence UAC. What will be the corresponding nucleotide sequence in the DNA? A ATG B AU…Question 131: A piece of double-stranded DNA containing 12  103 nucleotides is transcribed and translated to produce a single polypeptide. What is the m…34 / 58
Question 132: The statements describe the process of translation. 1 A peptide bond forms between adjacent amino acids. 2 Hydrogen bonds form between the …Question 133: The sequence of amino acids in a section of a polypeptide is: … histidine–proline–aspartic acid–leucine... amino acid possible DNA triplet …Question 134: Which sequence shows the correct order of some of the stages in the production and secretion of an enzyme? A Golgi body  ribosome  ro…35 / 58
Question 135: The diagram shows a strand of DNA and mRNA during transcription. 1 2 P C G P P G C P 3 Which row correctly identifies 1, 2 and 3? 1 2 3 A p…Question 136: Two students were discussing the involvement of DNA and RNA in transcription and translation.  Student 1 always stated correct facts.  St…Question 137: Some of the events that occur during transcription are listed. 1 Bonds break between complementary bases. 2 Bonds form between complementar…36 / 58
Question 138: The table shows the DNA triplet codes for some amino acids. amino acid DNA triplet code amino acid DNA triplet code arginine GCA glycine CC…Question 139: A gene codes for the sequence of amino acids in a single polypeptide. Haemoglobin consists of two -globins and two -globins. How many gen…Question 140: In which cell structures does DNA transcription occur? chloroplast A D mitochondrion nucleus C B37 / 58
Question 141: What is the correct tRNA anticodon coding for the amino acid proline? DNA triplet code amino acid on transcribed strand alanine CGT histidi…Question 142: The mRNA sequences of the three stop codons are shown. UAA UAG UGA Which mutation in the template (transcribed) strand of…Question 143: When a gene for protease is activated, which nucleic acid will be formed? A DNA B mRNA C rRNA D tRNAQuestion 144: A student sketched a diagram to represent the process of transcription. Which part of their diagram shows the non-transcribed strand? T A A…38 / 58
Question 145: Rifampicin is an antibiotic used to treat tuberculosis. It works by inhibiting RNA polymerase in bacteria. Which processes are directly inh…Question 146: The table shows the DNA triplet codes for some amino acids. amino acid DNA triplet code amino acid DNA triplet code arginine GCA glycine CC…Question 147: Which statement about the transcription and translation of a gene is correct? A The non-transcribed strand of DNA has a base sequence that …39 / 58
Question 148: Which statement about mRNA is correct? A The primary transcript becomes modified by the joining of introns to become mRNA. B The primary tr…Question 149: The sequence of bases in DNA coding for the first eight amino acids in the -polypeptide of adult haemoglobin is: CAC GTG GAC TGA GGA CTC C…40 / 58
Question 150: The sequence shows the series of bases at the start of a gene. TAC CGA CCA CCA CAA CCA CGA... After transcription, the mRNA was translated …Question 151: The table shows the mode of action of two antibacterial drugs that can affect the synthesis of proteins. antibacterial rifampicin streptomy…41 / 58
Question 152: A section of the polypeptide coding for the haemoglobin β-chain contains the following amino acids. – Pro – Glu – Glu – Patients with sickl…Question 153: Which diagram correctly represents temporary hydrogen bonding during transcription? A B C D A U C G G C T UQuestion 154: The diagram shows part of the DNA sequence of a gene and a mutated sequence of the same gene. normal DNA sequence ... CCG GAT TAT TGC GAG A…42 / 58
Question 155: Which letter represents cell structures where mRNA may be found? cytoplasm A C B mitochondrion nucleus DQuestion 156: Following translation, the alpha polypeptide chain of haemoglobin, α-globin, undergoes modification. During this modification, the first am…Question 157: Different tissues in a plant were supplied with a radioactively labelled substance to identify which tissues were actively synthesising mRN…Question 158: Which statement about messenger RNA is correct? A In eukaryotic cells, mRNA is made by removing exons from the primary RNA transcript. B mR…43 / 58
Question 159: Which structures are involved in transcription only? DNA template : RNA anticodons strand polymerase A WA J x B J x J Cc x Jv x D x x v k…Question 160: One gene provides the code for the production of which type of molecule? A amino acid B DNA C nucleotide D polypeptideQuestion 161: The table shows some mRNA codons that code for certain amino acids. mRNA codon amino acid GCG, GCA, GCC, GCU alanine ACG, ACA, ACC, ACU thr…44 / 58
Question 162: Which cell structures can have mRNA inside them? 1 chloroplast 2 mitochondrion 3 nucleus 4 rough endoplasmic reticulum A 1, 2, 3 and 4 B 1,…Question 163: One characteristic of DNA is that it is a universal genetic code. What is meant by a universal genetic code? A All living organisms use the…Question 164: Which statement about mRNA is correct? A It is a polymer made of nucleotides all joined with hydrogen bonds. B Each nucleotide subunit cont…45 / 58
Question 165: The diagram shows part of the process of translation. Z X Y What are the names of the structures labelled X, Y and Z? X Y Z A anticodon cod…Question 166: The DNA triplets of genes are translated as amino acids or stop signals during protein synthesis. The table shows some of these triplets. n…46 / 58
Question 167: The diagram shows the process of translation occurring at a ribosome. ribosome S C A U U C G C U A A U G What is the base sequen…Question 168: The RNA codon wheel is a tool used to find which amino acid would be translated from an mRNA sequence. Gly Phe Leu Glu Asp Ser CUAG CU AG A…47 / 58
Question 169: Which processes occur in eukaryotes and prokaryotes? 1 hydrolysis 2 mitosis 3 transcription 4 translation A 1, 2 and 3 B 1, 2 and 4 C 1, 3 …Question 170: The genome of the bacterium Escherichia coli has been altered to enable it to code for an amino acid that is not found in nature. All the A…Question 171: 40% of the bases in a section of a non-transcribed strand of DNA are purine molecules. What will be the total percentage of cytosine and ur…Question 172: Some vaccines do not contain antigens. The vaccines contain a molecule of mRNA. Cells in the immune system use the mRNA molecule to make a …Question 173: Which statements about complementary base pairing are correct? 1 Purines and pyrimidines are different sizes. 2 Complementary base pairing …48 / 58
Question 174: Which molecule has its synthesis directly controlled by DNA? A amylase B cholesterol C glycogen D phospholipidQuestion 175: What is the correct order of locations in the cell for the production of an extracellular enzyme? A nucleus  ribosome  rough endoplasmic …Question 176: The diagram shows the nucleotide sequence of a small section of the transcribed strand of a gene. CGG GCC CCG CGG The table shows the amino…Question 177: What does the process of translation require? A DNA, free nucleotide bases and mRNA B DNA, mRNA, amino acids and RNA polymerase C mRNA, rib…49 / 58
Question 178: Which statements about peptide bond formation are correct? 1 The bond formation occurs between a carbon of one amino acid and a nitrogen of…Question 179: The mRNA codons ACU, ACC, ACA and ACG all code for the same amino acid, threonine. Which anticodons could specify an amino acid other than …Question 180: In eukaryotes, the RNA molecules formed during transcription are modified by the removal of non-coding sequences. This is followed by the j…Question 181: A transcription error results in the deletion of one nucleotide from the middle of a primary transcript. mRNA forms from the primary transc…50 / 58
Question 182: Which statements correctly describe the process of translation? 1 The nucleotide sequence on an mRNA molecule is used to produce a specific…Question 183: A molecule of mRNA was used in translation. Part of its sequence is shown. GAU CUG UAA CGG There were no introns present in the se…Question 184: Which statement explains why lymphocytes with no nucleoli die? A The cells do not have centrioles and cannot divide. B The cells do not hav…Question 185: The statements describe processes that take place in a secretory cell. 1 Modification of the protein occurs in the Golgi body. 2 mRNA leave…51 / 58
Question 186: Which statements describe how a gene mutation can lead to the production of a non-functional protein? 1 During transcription, an incorrect …Question 187: The diagram shows the nucleotide sequence of a small section of the transcribed strand of a gene. GCG CGC GGC GCG The table shows the…Question 188: Which processes occur in bone marrow cells that are in a mitotic cell cycle? 1 Phosphate groups bind to ADP molecules to form ATP. 2 Bonds …52 / 58
Question 189: A polypeptide molecule contains the amino acid sequence: glycine – leucine – lysine – valine. The table shows DNA triplets for these amino …Question 190: During the production of protein molecules, only one strand from the DNA double helix is used. Which name is given to the DNA strand that i…Question 191: Which strand of DNA does RNA polymerase bind to? A lagging strand B leading strand C non-transcribed strand D template strandQuestion 192: Which processes occur during the formation of messenger RNA? 1 condensation 2 polymerisation 3 replication 4 transcription A 1, 2 and 3 B 1…Question 193: The anticodon for the amino acid tryptophan is ACC. What shows a template DNA sequence that includes the DNA triplet for tryptophan? A UGG …53 / 58
Question 194: The diagram represents the process of transcription of a gene in the nucleus of an animal cell. P Q RNA polymerase R Which row correctly id…Question 195: The table shows all the possible DNA triplet codes for some amino acids. DNA triplet amino acid code cysteine ACA cysteine ACG tryptophan A…Question 196: Which cell structures contain ribosomal RNA? 1 chloroplasts 2 mitochondria 3 nuclei A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 3 only54 / 58
Question 197: Which statements about tRNA are correct? 1 Hydrogen bonds between bases temporarily bond tRNA to mRNA. 2 The base sequences in the tRNA mol…Question 198: Why is the genetic code described as universal? A Each codon is made up of a sequence of three bases. B More than one codon can represent o…Question 199: Three proteins that have a quaternary structure are listed. ● Type IX collagen is formed from three different polymers. ● The main form of …Question 200: How many genes could code for one collagen molecule? A 1 gene only B 2 genes only C 3 genes only D 1 gene or 2 genes or 3 genes55 / 58
Question 201: The diagram shows some events during the formation of an mRNA molecule at transcription. P 5′ 3′ Q Q S R What is correctly identified in th…Question 202: The gene that codes for protein R is 130 kb long. Protein R is 220 kDa in mass. The typical mass of an amino acid is 110 Da. (1000 base pai…56 / 58
Question 203: The table shows some of the DNA triplet codes for some amino acids. amino acid DNA triplet code amino acid DNA triplet code arginine GCA gl…Question 204: Which statements about complementary base pairing are correct? 1 It occurs during translation. 2 Purines and pyrimidines are the same size.…Question 205: Which statement is correct for protein synthesis? A During translation, the strand of DNA used is the template strand. B mRNA is formed whe…57 / 58
Question 206: A mutation occurred in this original DNA nucleotide sequence. C T A G A A T C C T C T C C C After the mutation occurred, the new DNA nucleo…58 / 58

Mark scheme206 answers

Answers below. Sit the paper first if you are practising.

Pastlit

Biology 9700 · Protein synthesis — Paper 1

A Level · topical answer key — answer key (teacher use)

Question

Answer

Marks

1D1
2A1
3B1
4A1
5B1
6B1
7B1
8A1
9D1
10D1
11B1
12B1
13D1
14B1
15C1
16A1
17C1
18A1
19A1
20A1
21A1
22A1
23A1
24A1
25C1
26C1
27A1
28B1
29A1
30A1
31B1
32C1
33A1
34A1
35A1
36B1
37A1
38C1
39D1
40D1
41C1
42A1
43B1
44C1
45C1
46C1
47A1
48C1
49B1
1 / 5

Pastlit

Biology 9700 · Protein synthesis — Paper 1

A Level · topical answer key — answer key (teacher use)

Question

Answer

Marks

50D1
51B1
52B1
53C1
54B1
55A1
56D1
57B1
58D1
59C1
60A1
61C1
62B1
63A1
64C1
65A1
66B1
67D1
68D1
69C1
70C1
71A1
72D1
73B1
74A1
75C1
76D1
77B1
78B1
79D1
80B1
81A1
82B1
83A1
84A1
85B1
86—1
87—1
88—1
89A1
90D1
91C1
92D1
93C1
94A1
95B1
96A1
97C1
98D1
2 / 5

Pastlit

Biology 9700 · Protein synthesis — Paper 1

A Level · topical answer key — answer key (teacher use)

Question

Answer

Marks

99D1
100C1
101C1
102C1
103B1
104C1
105C1
106C1
107A1
108C1
109D1
110D1
111D1
112A1
113C1
114D1
115B1
116C1
117B1
118D1
119B1
120A1
121A1
122B1
123C1
124A1
125B1
126D1
127D1
128C1
129B1
130C1
131C1
132B1
133B1
134C1
135D1
136C1
137D1
138C1
139B1
140D1
141D1
142C1
143B1
144A1
145D1
146C1
147C1
3 / 5

Pastlit

Biology 9700 · Protein synthesis — Paper 1

A Level · topical answer key — answer key (teacher use)

Question

Answer

Marks

148B1
149A1
150B1
151B1
152D1
153B1
154D1
155B1
156D1
157C1
158C1
159B1
160D1
161C1
162B1
163A1
164B1
165B1
166C1
167C1
168C1
169C1
170B1
171D1
172C1
173B1
174A1
175A1
176B1
177D1
178D1
179B1
180B1
181D1
182C1
183C1
184D1
185B1
186D1
187C1
188A1
189B1
190C1
191D1
192B1
193D1
194D1
195C1
196A1
4 / 5

Pastlit

Biology 9700 · Protein synthesis — Paper 1

A Level · topical answer key — answer key (teacher use)

Question

Answer

Marks

197C1
198D1
199C1
200D1
201D1
202C1
203D1
204B1
205B1
206A1
5 / 5
QuestionAnswerMarksFrom
1D19700/11 Oct/Nov 2004
2A19700/11 Oct/Nov 2004
3B19700/11 Oct/Nov 2004
4A19700/11 Oct/Nov 2004
5B19700/11 Oct/Nov 2004
6B19700/11 May/June 2006
7B19700/11 May/June 2006
8A19700/11 Oct/Nov 2006
9D19700/11 Oct/Nov 2007
10D19700/11 Oct/Nov 2007
11B19700/11 Oct/Nov 2007
12B19700/11 May/June 2008
13D19700/11 May/June 2008
14B19700/11 Oct/Nov 2008
15C19700/11 Oct/Nov 2008
16A19700/11 Oct/Nov 2008
17C19700/12 Oct/Nov 2009
18A19700/12 Oct/Nov 2009
19A19700/11 May/June 2010
20A19700/11 May/June 2010
21A19700/12 May/June 2010
22A19700/13 May/June 2010
23A19700/12 Oct/Nov 2010
24A19700/11 May/June 2011
25C19700/12 May/June 2011
26C19700/12 May/June 2011
27A19700/13 May/June 2011
28B19700/11 Oct/Nov 2011
29A19700/11 Oct/Nov 2011
30A19700/13 Oct/Nov 2011
31B19700/13 Oct/Nov 2011
32C19700/11 May/June 2012
33A19700/11 May/June 2012
34A19700/12 May/June 2012
35A19700/12 May/June 2012
36B19700/12 May/June 2012
37A19700/13 May/June 2012
38C19700/13 May/June 2012
39D19700/11 Oct/Nov 2012
40D19700/11 Oct/Nov 2012
41C19700/12 Oct/Nov 2012
42A19700/12 Oct/Nov 2012
43B19700/13 Oct/Nov 2012
44C19700/13 Oct/Nov 2012
45C19700/13 Oct/Nov 2012
46C19700/11 May/June 2013
47A19700/11 May/June 2013
48C19700/12 May/June 2013
49B19700/12 May/June 2013
50D19700/13 May/June 2013
51B19700/13 May/June 2013
52B19700/12 Oct/Nov 2013
53C19700/12 Oct/Nov 2013
54B19700/12 Oct/Nov 2013
55A19700/12 Oct/Nov 2013
56D19700/13 Oct/Nov 2013
57B19700/13 Oct/Nov 2013
58D19700/11 May/June 2014
59C19700/12 May/June 2014
60A19700/13 May/June 2014
61C19700/13 May/June 2014
62B19700/11 Oct/Nov 2014
63A19700/11 Oct/Nov 2014
64C19700/12 Oct/Nov 2014
65A19700/13 Oct/Nov 2014
66B19700/11 May/June 2015
67D19700/12 May/June 2015
68D19700/12 May/June 2015
69C19700/13 May/June 2015
70C19700/13 May/June 2015
71A19700/13 May/June 2015
72D19700/11 Oct/Nov 2015
73B19700/11 Oct/Nov 2015
74A19700/12 Oct/Nov 2015
75C19700/12 Oct/Nov 2015
76D19700/13 Oct/Nov 2015
77B19700/13 Oct/Nov 2015
78B19700/12 Feb/March 2016
79D19700/12 Feb/March 2016
80B19700/12 Feb/March 2016
81A19700/11 May/June 2016
82B19700/11 May/June 2016
83A19700/12 May/June 2016
84A19700/12 May/June 2016
85B19700/12 May/June 2016
86see sheet19700/13 May/June 2016
87see sheet19700/13 May/June 2016
88see sheet19700/13 May/June 2016
89A19700/11 Oct/Nov 2016
90D19700/11 Oct/Nov 2016
91C19700/13 Oct/Nov 2016
92D19700/13 Oct/Nov 2016
93C19700/12 Feb/March 2017
94A19700/12 Feb/March 2017
95B19700/11 May/June 2017
96A19700/11 May/June 2017
97C19700/12 May/June 2017
98D19700/12 May/June 2017
99D19700/13 May/June 2017
100C19700/12 Oct/Nov 2017
101C19700/13 Oct/Nov 2017
102C19700/13 Oct/Nov 2017
103B19700/12 Feb/March 2018
104C19700/11 May/June 2018
105C19700/11 May/June 2018
106C19700/12 May/June 2018
107A19700/13 May/June 2018
108C19700/13 May/June 2018
109D19700/13 May/June 2018
110D19700/11 Oct/Nov 2018
111D19700/11 Oct/Nov 2018
112A19700/13 Oct/Nov 2018
113C19700/12 Feb/March 2019
114D19700/12 Feb/March 2019
115B19700/11 May/June 2019
116C19700/11 May/June 2019
117B19700/12 May/June 2019
118D19700/12 May/June 2019
119B19700/13 May/June 2019
120A19700/11 Oct/Nov 2019
121A19700/12 Oct/Nov 2019
122B19700/12 Oct/Nov 2019
123C19700/13 Oct/Nov 2019
124A19700/13 Oct/Nov 2019
125B19700/13 Oct/Nov 2019
126D19700/12 Feb/March 2020
127D19700/12 May/June 2020
128C19700/13 May/June 2020
129B19700/13 May/June 2020
130C19700/13 Oct/Nov 2020
131C19700/12 Feb/March 2021
132B19700/11 May/June 2021
133B19700/11 May/June 2021
134C19700/12 May/June 2021
135D19700/12 May/June 2021
136C19700/12 May/June 2021
137D19700/13 May/June 2021
138C19700/13 May/June 2021
139B19700/13 May/June 2021
140D19700/11 Oct/Nov 2021
141D19700/11 Oct/Nov 2021
142C19700/12 Oct/Nov 2021
143B19700/13 Oct/Nov 2021
144A19700/11 May/June 2022
145D19700/12 May/June 2022
146C19700/12 May/June 2022
147C19700/13 May/June 2022
148B19700/13 May/June 2022
149A19700/13 May/June 2022
150B19700/11 Oct/Nov 2022
151B19700/11 Oct/Nov 2022
152D19700/12 Oct/Nov 2022
153B19700/12 Oct/Nov 2022
154D19700/12 Oct/Nov 2022
155B19700/13 Oct/Nov 2022
156D19700/13 Oct/Nov 2022
157C19700/12 Feb/March 2023
158C19700/11 May/June 2023
159B19700/11 May/June 2023
160D19700/11 May/June 2023
161C19700/11 May/June 2023
162B19700/12 May/June 2023
163A19700/12 May/June 2023
164B19700/12 May/June 2023
165B19700/12 May/June 2023
166C19700/12 May/June 2023
167C19700/13 May/June 2023
168C19700/12 Oct/Nov 2023
169C19700/13 Oct/Nov 2023
170B19700/13 Oct/Nov 2023
171D19700/13 Oct/Nov 2023
172C19700/13 Oct/Nov 2023
173B19700/12 Feb/March 2024
174A19700/12 Feb/March 2024
175A19700/11 May/June 2024
176B19700/11 May/June 2024
177D19700/11 May/June 2024
178D19700/12 May/June 2024
179B19700/12 May/June 2024
180B19700/12 May/June 2024
181D19700/13 May/June 2024
182C19700/13 May/June 2024
183C19700/13 May/June 2024
184D19700/11 Oct/Nov 2024
185B19700/11 Oct/Nov 2024
186D19700/11 Oct/Nov 2024
187C19700/11 Oct/Nov 2024
188A19700/12 Oct/Nov 2024
189B19700/12 Oct/Nov 2024
190C19700/12 Oct/Nov 2024
191D19700/13 Oct/Nov 2024
192B19700/13 Oct/Nov 2024
193D19700/13 Oct/Nov 2024
194D19700/12 Feb/March 2025
195C19700/12 May/June 2025
196A19700/13 May/June 2025
197C19700/13 May/June 2025
198D19700/13 May/June 2025
199C19700/13 May/June 2025
200D19700/14 May/June 2025
201D19700/14 May/June 2025
202C19700/11 Oct/Nov 2025
203D19700/11 Oct/Nov 2025
204B19700/13 Oct/Nov 2025
205B19700/13 Oct/Nov 2025
206A19700/13 Oct/Nov 2025

Another paper, or another topic

Paper
Paper 1206 questionsPaper 2questions comingPaper 4questions comingPaper 5questions coming

All of Nucleic acids and protein synthesis →

Questions as text

Q1 · When not involved in protein synthesis, ribosomes exist as separate subunits 9700/11 Oct/Nov 2004

3 When not involved in protein synthesis, ribosomes exist as separate subunits. What do these subunits consist of? A mRNA and lipid B mRNA and tRNA C rRNA and lipid D rRNA and protein

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2004

Q2 · How many different polypeptides, each consisting of r amino acids, can be made if the… 9700/11 Oct/Nov 2004

13 How many different polypeptides, each consisting of r amino acids, can be made if the number of different amino acids available is n ? n r r n n A B C n x r D r

1 marks

Answer: A

This question in 9700/11 Oct/Nov 2004

Q3 · In the DNA sequence for sickle cell anaemia, adenine replaces thymine in a CTT triplet… 9700/11 Oct/Nov 2004

22 In the DNA sequence for sickle cell anaemia, adenine replaces thymine in a CTT triplet, forming the triplet CAT. During synthesis of the sickle cell haemoglobin molecule, the amino acid valine is incorporated instead of glutamic acid. What is the anticodon in the transfer RNA molecule carrying this valine? A CAT B CAU C GTA D GUA

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2004

Q4 · In transcription, what is transcribed and what is the product? 9700/11 Oct/Nov 2004

23 In transcription, what is transcribed and what is the product? transcribed product A DNA mRNA B DNA polypeptide C mRNA DNA D mRNA polypeptide

1 marks

Answer: A

This question in 9700/11 Oct/Nov 2004

Q5 · The table shows mRNA triplets and their corresponding amino acids 9700/11 Oct/Nov 2004

24 The table shows mRNA triplets and their corresponding amino acids. mRNA triplet GCA GCG GAA GAG AAA AAG amino acid ala ala glu glu lys lys A tripeptide is glu-lys-ala. Which sequence of bases in DNA could code for this tripeptide? A CTCCGTTTT B CTTTTCCGT C TTCCGTCTT D TTTCTCCGC

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2004

Q6 · In a genetic engineering experiment a piece of double-stranded DNA containing 6000… 9700/11 May/June 2006

23 In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides is transcribed and translated. What is the total number of amino acids used? A 500 B 1000 C 2000 D 3000

1 marks

Answer: B

This question in 9700/11 May/June 2006

Q7 · DNA from a chromosome is analysed and 20 % of its bases are found to be cytosine 9700/11 May/June 2006

24 DNA from a chromosome is analysed and 20 % of its bases are found to be cytosine. Which percentage of uracil molecules will be found in mRNA transcribed from this DNA? A 20 B 30 C 40 D 60

1 marks

Answer: B

This question in 9700/11 May/June 2006

Q8 · What terminates the formation of a polypeptide chain during protein synthesis in cells? 9700/11 Oct/Nov 2006

22 What terminates the formation of a polypeptide chain during protein synthesis in cells? A when a ‘stop’ codon is reached on the mRNA molecule B when a ‘stop’ codon is reached on the tRNA molecule C when the ribosome reaches the end of the mRNA molecule D when the ribosome reaches the end of the tRNA molecule

1 marks

Answer: A

This question in 9700/11 Oct/Nov 2006

Q9 · Which type of molecule is the end product of translation? 9700/11 Oct/Nov 2007

21 Which type of molecule is the end product of translation? A amino acid B DNA C mRNA D polypeptide

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2007

Q10 · An unidentified single-stranded molecule was described as having the following features 9700/11 Oct/Nov 2007

22 An unidentified single-stranded molecule was described as having the following features. • complementary base pairing along some of its length • an area that can attach to a ribosome • a site to which a specific amino acid attaches What is the unidentified molecule? A DNA polymerase B messenger RNA C RNA polymerase D transfer RNA

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2007

Q11 · Some antibacterial drugs can affect the synthesis of proteins 9700/11 Oct/Nov 2007

23 Some antibacterial drugs can affect the synthesis of proteins. antimicrobial rifampicin streptomycin tetracycline drug mode of binds to RNA genetic code misread prevents binding of action polymerase during translation tRNA to ribosome Which is the correct set of immediate effects of these drugs? antimicrobial rifampicin streptomycin tetracycline drug A defective protein mRNA does not bind to amino acids not added synthesised ribosome to growing chain B mRNA not synthesised defective protein amino acids not added synthesised to growing chain C mRNA not synthesised mRNA does not bind to transcription prevented ribosome D transcription prevented defective protein mRNA does not bind to synthesised ribosome

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2007

Q12 · The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide 9700/11 May/June 2008

21 The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide. The diagram shows a strand of DNA which codes for four amino acids. Where would a mutation, introducing a thymine nucleotide, result in the termination of transcription? T C C A C T C G A T G C A B C D

1 marks

Answer: B

This question in 9700/11 May/June 2008

Q13 · Part of the amino acid sequences in normal and sickle cell haemoglobin are shown 9700/11 May/June 2008

24 Part of the amino acid sequences in normal and sickle cell haemoglobin are shown. normal haemoglobin sickle cell haemoglobin thr-pro-glu-glu thr-pro-val-glu Possible mRNA codons for these amino acids are glutamine (glu) GAA GAG proline (pro) CCU CCC threonine (thr) ACU ACC valine (val) GUA GUG Which tRNA molecule is not involved in the formation of this part of the sickle cell haemoglobin? A B C D C U C U U A U C A U G G

1 marks

Answer: D

This question in 9700/11 May/June 2008

Q14 · Haemoglobin is a globular protein consisting of four polypeptide chains – 2 alpha chains… 9700/11 Oct/Nov 2008

10 Haemoglobin is a globular protein consisting of four polypeptide chains – 2 alpha chains and 2 beta chains. In normal individuals, in the DNA which codes for each beta chain, the sixth triplet has a code for glutamic acid. In individuals with sickle cell anaemia this base triplet changes and codes for valine. What aspect of the haemoglobin molecule does this mutation change? A the iron content B the primary structure C the quaternary structure D the secondary structure

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2008

Q15 · What is the function of the enzyme RNA polymerase? 9700/11 Oct/Nov 2008

21 What is the function of the enzyme RNA polymerase? A to form a polypeptide using mRNA as a template B to form a strand of DNA using mRNA as a template C to form a strand of mRNA using DNA as a template D to form a strand of mRNA using tRNA as a template

1 marks

Answer: C

This question in 9700/11 Oct/Nov 2008

Q16 · The table gives the tRNA anticodons for four amino acids 9700/11 Oct/Nov 2008

22 The table gives the tRNA anticodons for four amino acids. amino acid anticodon (tRNA) asparagine UUA glutamic acid CUU proline GGA threonine UGG A cell makes a polypeptide with the amino acid sequence: glutamic acid – asparagine – threonine – proline What was the sequence of bases on the strand of the DNA which was complimentary to the mRNA from which this polypeptide was formed? A CTTTTATGGGGA B CUUUUAUGGGGA C GAAAATACCCCT D GAAAAUACCCCU

1 marks

Answer: A

This question in 9700/11 Oct/Nov 2008

Q17 · The following statements describe events that take place during DNA replication and… 9700/12 Oct/Nov 2009

22 The following statements describe events that take place during DNA replication and transcription. Which statement is not correct? DNA transcription replication A adenine pairs with thymine yes no B both DNA polynucleotide chains act as templates yes no C the original DNA molecule is changed after the process no yes D uracil pairs with adenine no yes

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2009

Q18 · A peptide consists of ten amino acids of four different kinds 9700/12 Oct/Nov 2009

23 A peptide consists of ten amino acids of four different kinds. What is the theoretical minimum number of tRNA molecules required to translate the mRNA for this peptide? A 4 B 10 C 12 D 30

1 marks

Answer: A

This question in 9700/12 Oct/Nov 2009

Q19 · What is the minimum number of base substitutions required to change the nucleotide… 9700/11 May/June 2010

23 What is the minimum number of base substitutions required to change the nucleotide sequence of the HbA (normal) allele to the HbS (sickle cell) allele? A 1 B 2 C 3 D 4

1 marks

Answer: A

This question in 9700/11 May/June 2010

Q20 · In a DNA molecule, the base sequence AGT codes for the amino acid serine 9700/11 May/June 2010

24 In a DNA molecule, the base sequence AGT codes for the amino acid serine. What is the base sequence of the anti-codon on the tRNA to which serine becomes attached? A AGU B GAU C TCA D UCA

1 marks

Answer: A

This question in 9700/11 May/June 2010

Q21 · In a DNA molecule, the base sequence AGT codes for the amino acid serine 9700/12 May/June 2010

22 In a DNA molecule, the base sequence AGT codes for the amino acid serine. What is the base sequence of the anti-codon on the tRNA to which serine becomes attached? A AGU B GAU C TCA D UCA

1 marks

Answer: A

This question in 9700/12 May/June 2010

Q22 · In a DNA molecule, the base sequence AGT codes for the amino acid serine 9700/13 May/June 2010

40 In a DNA molecule, the base sequence AGT codes for the amino acid serine. What is the base sequence of the anti-codon on the tRNA to which serine becomes attached? A AGU B GAU C TCA D UCA

1 marks

Answer: A

This question in 9700/13 May/June 2010

Q23 · Which row shows the correct combination? 9700/12 Oct/Nov 2010

20 Which row shows the correct combination? triplet code codon anticodon A DNA mRNA tRNA B DNA tRNA mRNA C mRNA DNA tRNA D tRNA mRNA DNA

1 marks

Answer: A

This question in 9700/12 Oct/Nov 2010

Q24 · The following events occur during transcription 9700/11 May/June 2011

22 The following events occur during transcription. 1 Bonds break between complementary bases. 2 Bonds form between complementary bases. 3 Sugar-phosphate bonds form. 4 Free nucleotides pair with complementary nucleotides. Before the mRNA leaves the nucleus, which events will have occurred twice? A 1 and 2 only B 1, 3 and 4 only C 2, 3 and 4 only D 1, 2, 3 and 4

1 marks

Answer: A

This question in 9700/11 May/June 2011

Q25 · The table shows the tRNA anticodons for four amino acids 9700/12 May/June 2011

21 The table shows the tRNA anticodons for four amino acids. amino acid anticodon (tRNA) asparagine UUA glutamic acid CUU proline GGA threonine UGG A cell makes a polypeptide with the following amino acid sequence. glutamic acid – asparagine – threonine – proline What was the sequence of bases on the DNA from which this was formed? A GGAAATACCCTT B CAAAATACCCCT C CTTTTATGGGGA D CTTTTATCCGGA

1 marks

Answer: C

This question in 9700/12 May/June 2011

Q26 · What does the enzyme RNA polymerase synthesise? 9700/12 May/June 2011

22 What does the enzyme RNA polymerase synthesise? A a polypeptide from an mRNA template B a strand of DNA from an mRNA template C mRNA from a DNA template D mRNA from a tRNA template

1 marks

Answer: C

This question in 9700/12 May/June 2011

Q27 · The following events occur during transcription 9700/13 May/June 2011

29 The following events occur during transcription. 1 Bonds break between complementary bases. 2 Bonds form between complementary bases. 3 Sugar-phosphate bonds form. 4 Free nucleotides pair with complementary nucleotides. Before the mRNA leaves the nucleus, which events will have occurred twice? A 1 and 2 only B 1, 3 and 4 only C 2, 3 and 4 only D 1, 2, 3 and 4

1 marks

Answer: A

This question in 9700/13 May/June 2011

Q28 · In a genetic engineering experiment a piece of double-stranded DNA containing 6000… 9700/11 Oct/Nov 2011

20 In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides coding for a specific polypeptide is transcribed and translated. What is the total number of amino acids in this polypeptide? A 500 B 1000 C 2000 D 3000

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2011

Q29 · Which molecule has its synthesis directly controlled by DNA? 9700/11 Oct/Nov 2011

22 Which molecule has its synthesis directly controlled by DNA? A amylase B cholesterol C glycogen D phospholipid

1 marks

Answer: A

This question in 9700/11 Oct/Nov 2011

Q30 · Which molecule has its synthesis directly controlled by DNA? 9700/13 Oct/Nov 2011

30 Which molecule has its synthesis directly controlled by DNA? A amylase B cholesterol C glycogen D phospholipid

1 marks

Answer: A

This question in 9700/13 Oct/Nov 2011

Q31 · In a genetic engineering experiment a piece of double-stranded DNA containing 6000… 9700/13 Oct/Nov 2011

32 In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides coding for a specific polypeptide is transcribed and translated. What is the total number of amino acids in this polypeptide? A 500 B 1000 C 2000 D 3000

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2011

Q32 · Which statement describes a process that occurs during protein synthesis? 9700/11 May/June 2012

20 Which statement describes a process that occurs during protein synthesis? A Transcription is the linking together of a tRNA molecule and a specific amino acid. B Transcription is the linking together of free DNA nucleotides. C Translation is the linking together of amino acids coded for by mRNA. D Translation is the synthesis of an mRNA molecule by base pairing of nucleotides with DNA.

1 marks

Answer: C

This question in 9700/11 May/June 2012

Q33 · A length of double-stranded DNA contains 120 nucleotides and codes for polypeptide X 9700/11 May/June 2012

22 A length of double-stranded DNA contains 120 nucleotides and codes for polypeptide X. What is the maximum length of polypeptide X? A 20 amino acids B 40 amino acids C 60 amino acids D 120 amino acids

1 marks

Answer: A

This question in 9700/11 May/June 2012

Q34 · What does the process of transcription require? 9700/12 May/June 2012

19 What does the process of transcription require? A ATP, DNA and free nucleotide bases B DNA, mRNA and RNA polymerase C mRNA, ribosomes and RNA polymerase D ribosomes, tRNA and ATP

1 marks

Answer: A

This question in 9700/12 May/June 2012

Q35 · A peptide consists of ten amino acids of four different kinds 9700/12 May/June 2012

20 A peptide consists of ten amino acids of four different kinds. What is the theoretical minimum number of different tRNA molecules required to translate the mRNA for this peptide? A 4 B 10 C 12 D 30

1 marks

Answer: A

This question in 9700/12 May/June 2012

Q36 · Which statements about tRNA structure are correct? 9700/12 May/June 2012

21 Which statements about tRNA structure are correct? 1 There is a binding site for the attachment of a specific amino acid, as well as a different binding site for the attachment to the ribosome, in order to allow translation to occur. 2 There is a ribose-phosphate backbone with strong covalent phosphodiester bonds and areas within the polynucleotide chain where base-pairing by hydrogen bonding occurs. 3 There is a section known as an anticodon that contains the same triplet of bases as the triplet of DNA bases that has been transcribed to produce the mRNA codon. A 1 only B 1 and 2 only C 2 and 3 only D 1, 2 and 3

1 marks

Answer: B

This question in 9700/12 May/June 2012

Q37 · A length of double-stranded DNA contains 120 nucleotides and codes for polypeptide X 9700/13 May/June 2012

23 A length of double-stranded DNA contains 120 nucleotides and codes for polypeptide X. What is the maximum length of polypeptide X? A 20 amino acids B 40 amino acids C 60 amino acids D 120 amino acids

1 marks

Answer: A

This question in 9700/13 May/June 2012

Q38 · Which statement describes a process that occurs during protein synthesis? 9700/13 May/June 2012

24 Which statement describes a process that occurs during protein synthesis? A Transcription is the linking together of a tRNA molecule and a specific amino acid. B Transcription is the linking together of free DNA nucleotides. C Translation is the linking together of amino acids coded for by mRNA. D Translation is the synthesis of an mRNA molecule by base pairing of nucleotides with DNA.

1 marks

Answer: C

This question in 9700/13 May/June 2012

Q39 · What does the process of translation require? 9700/11 Oct/Nov 2012

20 What does the process of translation require? A DNA, free nucleotide bases and mRNA B DNA, mRNA and RNA polymerase C mRNA, ribosomes and RNA polymerase D mRNA, ribosomes and tRNA

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2012

Q40 · Which features of DNA enable it to meet these requirements as a molecule of inheritance? 9700/11 Oct/Nov 2012

21 Which features of DNA enable it to meet these requirements as a molecule of inheritance? requirement of DNA molecule ability to remain ability to contain ability to transfer ability to replicate stable information information A complementary formation of mRNA sequence of sugar-phosphate base pairing for translation nucleotides backbone B formation of mRNA complementary sugar-phosphate sequence of for translation base pairing backbone nucleotides C sequence of sugar-phosphate complementary formation of mRNA nucleotides backbone base pairing for translation D sugar-phosphate sequence of formation of mRNA complementary backbone nucleotides for translation base pairing

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2012

Q41 · Which row in the table correctly shows situations in which both DNA and RNA are both… 9700/12 Oct/Nov 2012

22 Which row in the table correctly shows situations in which both DNA and RNA are both involved? replication | transcription | translation v v x key JY involved 0 0O DW > Jv x Jv x Jv x X not involved x x Jv

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2012

Q42 · The diagram shows the stages in the production of a polypeptide 9700/12 Oct/Nov 2012

23 The diagram shows the stages in the production of a polypeptide. DNA nucleotide sequence template strand T A C G A C A A T C G C mRNA sequence A U G C U G U U A G C G amino acid sequence met leu leu ala Which feature of the triplet code is illustrated by the information given? A An amino acid can be coded for by more than one triplet. B The triplet code is non-overlapping and is only read in one direction. C The triplet code is universal for the DNA of all organisms. D There are some triplets that code for ‘start’ and ‘stop’.

1 marks

Answer: A

This question in 9700/12 Oct/Nov 2012

Q43 · The sequence of nucleotides in DNA in a gene that controls the synthesis of a protein is… 9700/13 Oct/Nov 2012

19 The sequence of nucleotides in DNA in a gene that controls the synthesis of a protein is arranged in triplets, each coding for specific amino acids. The table shows three examples of these triplets. triplet code example 1 DNA code TAC 2 mRNA code AUG 3 tRNA code UAC Which are the correct codon and anticodon? codon anticodon A 1 3 B 2 3 C 3 1 D 3 2

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2012

Q44 · Enzymes are ……1…… proteins, made up of polypeptides 9700/13 Oct/Nov 2012

20 Enzymes are ……1…… proteins, made up of polypeptides. A gene is a sequence of ……2……, which are parts of a ……3…… molecule coding for a polypeptide. Which words correctly complete gaps 1, 2 and 3 in the sentences? 1 2 3 A fibrous amino acids tRNA B fibrous bases DNA C globular nucleotides DNA D globular triplets mRNA

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2012

Q45 · Which process does not occur during the formation of messenger RNA? 9700/13 Oct/Nov 2012

21 Which process does not occur during the formation of messenger RNA? A condensation B polymerisation C replication D transcription

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2012

Q46 · Which type of molecule is always the end product of transcription? 9700/11 May/June 2013

23 Which type of molecule is always the end product of transcription? A amino acid B functional protein C mRNA D polypeptide

1 marks

Answer: C

This question in 9700/11 May/June 2013

Q47 · The table gives tRNA anticodons for four amino acids 9700/11 May/June 2013

24 The table gives tRNA anticodons for four amino acids. amino acid tRNA anticodon asparagine UUA glutamic acid CUU proline GGA threonine UGG A cell makes a polypeptide with the amino acid sequence: glutamic acid – asparagine – threonine – proline What was the sequence of bases on the strand of the DNA which was complementary to the mRNA from which this polypeptide was formed? A CTTTTATGGGGA B CUUUUAUGGGGA C GAAAATACCCCT D GAAAAUACCCCU

1 marks

Answer: A

This question in 9700/11 May/June 2013

Q48 · Which type of molecule is the end product of translation? 9700/12 May/June 2013

23 Which type of molecule is the end product of translation? A amino acid B mRNA C polypeptide D tRNA

1 marks

Answer: C

This question in 9700/12 May/June 2013

Q49 · A polypeptide molecule contains the amino acid sequence: glycine – leucine – lysine… 9700/12 May/June 2013

24 A polypeptide molecule contains the amino acid sequence: glycine – leucine – lysine – valine. The table shows DNA codes for these amino acids. glycine leucine lysine valine CCC GAA TTT CAA Which tRNA anticodons are needed for the synthesis of this polypeptide? A CCC GAA TTT CAA B CCC GAA UUU CAA C GGG CUU AAA GUU D GGG CUU UUU GUU

1 marks

Answer: B

This question in 9700/12 May/June 2013

Q50 · One gene provides the code for the production of which molecule? 9700/13 May/June 2013

22 One gene provides the code for the production of which molecule? A amino acid B DNA C nucleotide D polypeptide

1 marks

Answer: D

This question in 9700/13 May/June 2013

Q51 · A polypeptide has the amino acid sequence glycine – arginine – lysine – serine 9700/13 May/June 2013

23 A polypeptide has the amino acid sequence glycine – arginine – lysine – serine. The table gives possible tRNA anticodons for each amino acid. amino acid tRNA anticodons arginine UCC GCG glycine CCA CCU lysine UUC UUU serine AGG UCG Which sequence of bases on DNA would code for the polypeptide? A CCACGCAAGAGC B CCTTCCTTCTCG C GGAAGGAAAAGC D GGTTGGTTGTGC

1 marks

Answer: B

This question in 9700/13 May/June 2013

Q52 · A piece of mammalian tissue was homogenised and centrifuged 9700/12 Oct/Nov 2013

3 A piece of mammalian tissue was homogenised and centrifuged. The biochemical activity of four subcellular fractions was investigated. Which diagram indicates the fraction with maximum synthesis of messenger RNA? A B lysosomes mitochondria mitochondria activity nuclei ribosomes activity nuclei lysosomes ribosomes C D mitochondria mitochondria lysosomes ribosomes activity activity nuclei ribosomes lysosomes nuclei

1 marks

Answer: B

This question in 9700/12 Oct/Nov 2013

Q53 · The following statements describe events that take place during DNA replication and… 9700/12 Oct/Nov 2013

19 The following statements describe events that take place during DNA replication and transcription. Which row is not correct? DNA transcription replication A adenine pairs with thymine yes no B both DNA polynucleotide chains act as templates yes no C the original DNA molecule is changed after the process no yes D uracil pairs with adenine no yes

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2013

Q54 · Which statements about complementary base pairing are correct? 9700/12 Oct/Nov 2013

20 Which statements about complementary base pairing are correct? 1 Purines and pyrimidines are different sizes. 2 It occurs during translation. 3 The base pairs are of different length. 4 Uracil forms two hydrogen bonds with adenine. A 1, 2 and 3 only B 1, 2 and 4 only C 1, 3 and 4 only D 2, 3 and 4 only

1 marks

Answer: B

This question in 9700/12 Oct/Nov 2013

Q55 · What is the minimum number of base substitutions required to change the nucleotide… 9700/12 Oct/Nov 2013

21 What is the minimum number of base substitutions required to change the nucleotide sequence of the HbA (normal) allele to the HbS (sickle cell) allele? A 1 B 2 C 3 D 4

1 marks

Answer: A

This question in 9700/12 Oct/Nov 2013

Q56 · What explains why cells with no nucleoli die? 9700/13 Oct/Nov 2013

3 What explains why cells with no nucleoli die? A They do not have centrioles and cannot divide. B They do not have mitochondria and cannot release energy. C They do not have mRNA and cannot transcribe DNA. D They do not have ribosomes and cannot synthesise protein.

1 marks

Answer: D

This question in 9700/13 Oct/Nov 2013

Q57 · Which statements about complementary base pairing are correct? 9700/13 Oct/Nov 2013

21 Which statements about complementary base pairing are correct? 1 It occurs during translation. 2 Purines and pyrimidines are the same size. 3 The base pairs are of equal length. 4 Uracil forms three hydrogen bonds with adenine. A 1 and 2 only B 1 and 3 only C 2 and 3 only D 3 and 4 only

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2013

Q58 · Part of the amino acid sequences in normal and sickle cell haemoglobin are shown 9700/11 May/June 2014

22 Part of the amino acid sequences in normal and sickle cell haemoglobin are shown. normal haemoglobin sickle cell haemoglobin thr-pro-glu-glu thr-pro-val-glu Possible mRNA codons for these amino acids are shown below. glutamine (glu) GAA GAG proline (pro) CCU CCC threonine (thr) ACU ACC valine (val) GUA GUG Which tRNA molecule is not involved in the formation of this part of the sickle cell haemoglobin? A B C D C U C U U A U C A U G G

1 marks

Answer: D

This question in 9700/11 May/June 2014

Q59 · What is the correct sequence for the processes involved in the formation of an enzyme in… 9700/12 May/June 2014

21 What is the correct sequence for the processes involved in the formation of an enzyme in a cell? A transcription → condensation → translation → ionic bonding B translation → hydrogen bonding → transcription → condensation C transcription → translation → condensation → ionic bonding D translation → transcription → ionic bonding → hydrogen bonding

1 marks

Answer: C

This question in 9700/12 May/June 2014

Q60 · What terminates the formation of a polypeptide chain during protein synthesis in cells? 9700/13 May/June 2014

24 What terminates the formation of a polypeptide chain during protein synthesis in cells? A when a ‘stop’ codon is reached on the mRNA molecule B when a ‘stop’ codon is reached on the tRNA molecule C when the ribosome reaches the end of the mRNA molecule D when the ribosome reaches the end of the tRNA molecule

1 marks

Answer: A

This question in 9700/13 May/June 2014

Q61 · The growth of crop plants is often limited by the availability of nitrogen in the soil 9700/13 May/June 2014

40 The growth of crop plants is often limited by the availability of nitrogen in the soil. The graph shows the results of an investigation into the yield of a crop plant, with increasing levels of nitrogen supplied. 7 6 5 yield of a crop plant 4 / tonnes per ha 3 2 1 0 0 40 80 120 160 nitrogen supplied / kg per ha Which of the following best explains the shape of this curve? protein synthesis DNA synthesis A increases no effect B no effect no effect C increases increases D no effect increases

1 marks

Answer: C

This question in 9700/13 May/June 2014

Q62 · Some antibiotics work by binding to ribosomes and preventing protein synthesis 9700/11 Oct/Nov 2014

19 Some antibiotics work by binding to ribosomes and preventing protein synthesis. Which statement explains why these antibiotics kill bacterial cells but not human cells? A In bacterial cells mRNA is formed in the cytoplasm from naked DNA. B Ribosomes in human cells have a different structure from those in bacterial cells. C The antibiotics cannot pass through human cell surface membranes. D The tRNA molecules in bacterial cells are different from those in human cells.

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2014

Q63 · Which statements about tRNA are correct? 9700/11 Oct/Nov 2014

20 Which statements about tRNA are correct? 1 contains base pairing 2 contains hydrogen bonds 3 is single stranded A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: A

This question in 9700/11 Oct/Nov 2014

Q64 · Which sequence shows some of the stages in the production and secretion of an enzyme? 9700/12 Oct/Nov 2014

5 Which sequence shows some of the stages in the production and secretion of an enzyme? A Golgi apparatus → ribosome → rough endoplasmic reticulum → mRNA B mRNA → smooth endoplasmic reticulum → Golgi apparatus → vesicle C ribosome → rough endoplasmic reticulum → vesicle → Golgi apparatus D smooth endoplasmic reticulum → mRNA → vesicle → ribosome

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2014

Q65 · Which molecules are involved in transcription and which molecules are involved in… 9700/13 Oct/Nov 2014

21 Which molecules are involved in transcription and which molecules are involved in translation? transcription translation A DNA and mRNA mRNA and tRNA B DNA and tRNA mRNA and amino acids C mRNA and amino acids DNA and mRNA D tRNA and mRNA amino acids and DNA

1 marks

Answer: A

This question in 9700/13 Oct/Nov 2014

Q66 · Which row shows two pairs of nucleotides formed during transcription? 9700/11 May/June 2015

20 Which row shows two pairs of nucleotides formed during transcription? first base pair transcribed second base pair transcribed number of number of bases bases hydrogen bonds hydrogen bonds A AU 2 CG 2 B AU 2 CG 3 C AU 2 TU 2 D AU 3 CG 2

1 marks

Answer: B

This question in 9700/11 May/June 2015

Q67 · What is needed to transcribe DNA? 9700/12 May/June 2015

20 What is needed to transcribe DNA? A DNA ligase B DNA polymerase C ribosomes D RNA polymerase

1 marks

Answer: D

This question in 9700/12 May/June 2015

Q68 · In a ribosome, which bond holds together two adjacent amino acids? 9700/12 May/June 2015

21 In a ribosome, which bond holds together two adjacent amino acids? A disulfide B hydrogen C ionic D peptide

1 marks

Answer: D

This question in 9700/12 May/June 2015

Q69 · Ribosomes exist as separate subunits that bind together during protein synthesis 9700/13 May/June 2015

4 Ribosomes exist as separate subunits that bind together during protein synthesis. What do these subunits consist of? A mRNA and protein B mRNA and tRNA C rRNA and protein D rRNA and tRNA

1 marks

Answer: C

This question in 9700/13 May/June 2015

Q70 · Which row shows two pairs of nucleotides formed when mRNA is translated? 9700/13 May/June 2015

21 Which row shows two pairs of nucleotides formed when mRNA is translated? first base pair translated second base pair translated number of number of bases present bases present hydrogen bonds hydrogen bonds A AT 2 TU 2 B AU 2 AT 2 C AU 2 GC 3 D AU 3 GC 3

1 marks

Answer: C

This question in 9700/13 May/June 2015

Q71 · Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the… 9700/13 May/June 2015

22 Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA CTGACTCCTGAGGAGAAGTCT HbS CTGACTCCTGTGGAGAAGTCT How will the mutation in the HbS allele result in the production of an altered version of the β-globin polypeptide? A A tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA. B All the amino acids coded for after the mutation will differ from those in the HbA protein. C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC. D The ribosome will be unable to continue translation of the HbS mRNA after the altered codon.

1 marks

Answer: A

This question in 9700/13 May/June 2015

Q72 · The statements describe the features of some nucleic acids 9700/11 Oct/Nov 2015

20 The statements describe the features of some nucleic acids. 1 carry an amino acid to a ribosome 2 carry a genetic code sequence out of the nucleus 3 carry a genetic code sequence to a ribosome Which functions are carried out only by mRNA? A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2015

Q73 · The antibiotic chloramphenicol prevents prokayotes from reproducing by inhibiting the… 9700/11 Oct/Nov 2015

21 The antibiotic chloramphenicol prevents prokayotes from reproducing by inhibiting the enzyme which catalyses the formation of peptide bonds during translation. What will be prevented by the action of this antibiotic? A binding of amino acids to tRNA B condensation of amino acids C pairing between codons and anticodons D positioning of amino acids by tRNA

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2015

Q74 · What occurs during DNA replication and transcription and translation? 9700/12 Oct/Nov 2015

20 What occurs during DNA replication and transcription and translation? 1 ATP provides energy. 2 Condensation reactions occur to form a polymer. 3 Hydrogen bonds form between purine and pyrimidine bases. A 1, 2 and 3 B 1 and 2 only C 2 only D 3 only

1 marks

Answer: A

This question in 9700/12 Oct/Nov 2015

Q75 · Ricin is a toxic protein which inactivates ribosomes 9700/12 Oct/Nov 2015

21 Ricin is a toxic protein which inactivates ribosomes. Which effect will this have on protein synthesis? A Amino acids will be unable to bind to the binding sites on specific tRNA molecules. B Anticodons on mRNA molecules will not base pair to codons on tRNA molecules. C Peptide bonds will not form between adjacent amino acids in the growing polypeptide. D RNA nucleotides will be unable to join by condensation reactions to form rRNA.

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2015

Q76 · Which statements describe how a gene mutation can lead to the production of a… 9700/13 Oct/Nov 2015

20 Which statements describe how a gene mutation can lead to the production of a non-functional protein? 1 During transcription an incorrect nucleotide is added to a DNA molecule. 2 A codon in the mRNA transcribed from the mutated gene is changed. 3 The order of the bases in an anticodon on tRNA is altered during translation. A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 2 only

1 marks

Answer: D

This question in 9700/13 Oct/Nov 2015

Q77 · Some antibiotics kill prokaryotes by binding to RNA polymerase 9700/13 Oct/Nov 2015

21 Some antibiotics kill prokaryotes by binding to RNA polymerase. What effect will this have on protein synthesis? A Codons on mRNA will be unable to hydrogen bond to complementary anticodons on tRNA. B Condensation reactions joining RNA nucleotides will not take place to form mRNA. C DNA will not unwind and unzip to allow for base-pairing with RNA nucleotides. D Free RNA nucleotides will not base-pair to exposed bases on the DNA template strand.

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2015

Q78 · The electron micrograph shows part of a eukaryotic cell 9700/12 Feb/March 2016

2 The electron micrograph shows part of a eukaryotic cell. Which of the labelled organelles is a site of protein synthesis? A B C D

1 marks

Answer: B

This question in 9700/12 Feb/March 2016

Q79 · One gene provides the code for the production of which type of molecule? 9700/12 Feb/March 2016

21 One gene provides the code for the production of which type of molecule? A amino acid B DNA C nucleotide D polypeptide

1 marks

Answer: D

This question in 9700/12 Feb/March 2016

Q80 · The table shows the mode of action of two antibacterial drugs that can affect the… 9700/12 Feb/March 2016

22 The table shows the mode of action of two antibacterial drugs that can affect the synthesis of proteins. antibacterial rifampicin streptomycin drug mode of binds to RNA causes errors in action polymerase translation If bacteria are treated with both drugs, what will be the immediate effects? 1 Transcription will stop, but faulty proteins may continue to be synthesised. 2 If translation has started, proteins may be faulty. 3 Translation will be inhibited. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: B

This question in 9700/12 Feb/March 2016

Q81 · The diagram shows the nucleotide sequence of a small section of a gene which is… 9700/11 May/June 2016

21 The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. CGCCGCACGCGC The table shows the amino acids coded for by 10 mRNA codons. mRNA codon amino acid AAG Lys ACG Thr CGG CGC CGU Arg CCG Pro GCC GCG Ala GGC Gly UGC Cys What is the order of the four amino acids in the polypeptide translated from this small section of a gene? A Ala-Ala-Cys-Ala B Ala-Arg-Gly-Ala C Arg-Ala-Pro-Arg D Arg-Arg-Thr-Arg

1 marks

Answer: A

This question in 9700/11 May/June 2016

Q82 · The statements describe the features of some nucleic acids 9700/11 May/June 2016

22 The statements describe the features of some nucleic acids. 1 carry an amino acid to a ribosome 2 carry a genetic code sequence out of the nucleus 3 carry a genetic code sequence to a ribosome 4 hold amino acids in position for translation Which functions are carried out by tRNA? A 1 and 2 B 1 and 4 C 2 and 3 D 3 and 4

1 marks

Answer: B

This question in 9700/11 May/June 2016

Q83 · Which statements about complementary base pairing are correct? 9700/12 May/June 2016

19 Which statements about complementary base pairing are correct? 1 Cytosine forms three hydrogen bonds with guanine. 2 Purines and pyrimidines are different sizes. 3 It allows transcription to occur. 4 The base pairs are of different lengths. A 1, 2 and 3 B 1, 2 and 4 C 1, 3 and 4 D 2, 3 and 4

1 marks

Answer: A

This question in 9700/12 May/June 2016

Q84 · Which statements about tRNA are correct? 9700/12 May/June 2016

21 Which statements about tRNA are correct? 1 It contains base pairing. 2 It contains hydrogen bonds. 3 It contains uracil. 4 It is single stranded. A 1, 2, 3 and 4 B 1, 3 and 4 only C 1 and 2 only D 2 and 3 only

1 marks

Answer: A

This question in 9700/12 May/June 2016

Q85 · The diagram shows the nucleotide sequence of a small section of a gene which is… 9700/12 May/June 2016

22 The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. TTCTTCCCGTTC The table shows the amino acids coded for by 10 mRNA codons. mRNA codon amino acid AAG Lys ACG Thr CGG CGC CGU Arg CCG Pro GCC GCG Ala GGC Gly UGC Cys What is the order of the four amino acids in the polypeptide translated from this small section of a gene? A Cys-Cys-Gly-Cys B Lys-Lys-Gly-Lys C Lys-Lys-Pro-Lys D Thr-Thr-Pro-Thr

1 marks

Answer: B

This question in 9700/12 May/June 2016

Q86 · Which types of RNA are found in both prokaryotic and eukaryotic cells? 9700/13 May/June 2016

5 Which types of RNA are found in both prokaryotic and eukaryotic cells? mRNA rRNA tRNA v v v key /¥ = present X = absent 0 OD D> ~ « & a aN x < x

1 marks

This question in 9700/13 May/June 2016

Q87 · Which processes occur in bone marrow cells that are in a mitotic cell cycle? 9700/13 May/June 2016

18 Which processes occur in bone marrow cells that are in a mitotic cell cycle? 1 phosphate groups bind to ADP molecules to form ATP 2 bonds form between nucleotides in a DNA strand 3 tRNA anticodons hydrogen bond with codons on mRNA A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 only

1 marks

This question in 9700/13 May/June 2016

Q88 · The diagram shows the nucleotide sequence of a small section of a gene which is… 9700/13 May/June 2016

22 The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. CGGGCCCCGCGG The table shows the amino acids coded for by 10 mRNA codons. mRNA codon amino acid AAG Lys ACG Thr CGG CGC CGU Arg CCG Pro GCC GCG Ala GGC Gly UGC Cys What is the order of the four amino acids in the polypeptide translated from this small section of a gene? A Ala-Ala-Cys-Ala B Ala-Arg-Gly-Ala C Arg-Ala-Pro-Arg D Arg-Arg-Thr-Arg

1 marks

This question in 9700/13 May/June 2016

Q89 · When a gene mutation occurs, which of the following may be altered, resulting in the… 9700/11 Oct/Nov 2016

21 When a gene mutation occurs, which of the following may be altered, resulting in the production of a non-functional protein? 1 amino acid sequence 2 DNA nucleotide sequence 3 mRNA nucleotide sequence A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 2 only

1 marks

Answer: A

This question in 9700/11 Oct/Nov 2016

Q90 · The diagram shows the nucleotide sequence of a small section of a gene which is… 9700/11 Oct/Nov 2016

22 The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. GCAGCATGCGCG The table shows the amino acids coded for by 10 mRNA codons. mRNA codon amino acid AAG Lys ACG Thr CGG CGC CGU Arg CCG Pro GCC GCG Ala GGC Gly UGC Cys What is the order of the four amino acids in the polypeptide translated from this small section of a gene? A Ala-Ala-Cys-Ala B Ala-Arg-Gly-Ala C Arg-Ala-Pro-Arg D Arg-Arg-Thr-Arg

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2016

Q91 · The diagram shows the nucleotide sequence of a small section of a gene which is… 9700/13 Oct/Nov 2016

21 The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. GCGCGCGGCCGC The table shows the amino acids coded for by 10 mRNA codons. mRNA codon amino acid AAG Lys ACG Thr CGG CGC CGU Arg CCG Pro GCC GCG Ala GGC Gly UGC Cys What is the order of the four amino acids in the polypeptide translated from this small section of a gene? A Ala-Ala-Cys-Ala B Ala-Arg-Gly-Ala C Arg-Ala-Pro-Ala D Arg-Arg-Thr-Arg

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2016

Q92 · The following events occur during transcription 9700/13 Oct/Nov 2016

22 The following events occur during transcription. 1 Bonds break between complementary bases. 2 Bonds form between complementary bases. 3 Sugar-phosphate bonds form. 4 Free nucleotides pair with complementary nucleotides. Before the mRNA molecule leaves the nucleus, which events will have occurred twice? A 1, 2, 3 and 4 B 1, 3 and 4 only C 2, 3 and 4 only D 1 and 2 only

1 marks

Answer: D

This question in 9700/13 Oct/Nov 2016

Q93 · Rifampicin is an antibiotic used to treat tuberculosis 9700/12 Feb/March 2017

25 Rifampicin is an antibiotic used to treat tuberculosis. It works by inhibiting RNA polymerase in bacteria. Which of these processes will be directly inhibited by this antibiotic? 1 ATP synthesis 2 transcription 3 translation A 1 and 2 B 1 and 3 C 2 only D 3 only

1 marks

Answer: C

This question in 9700/12 Feb/March 2017

Q94 · The diagram shows the stages in the production of part of a polypeptide 9700/12 Feb/March 2017

27 The diagram shows the stages in the production of part of a polypeptide. DNA nucleotide sequence template strand T A C G A C A A T C G C mRNA sequence A U G C U G U U A G C G amino acid sequence met leu leu ala Which feature of the triplet code is illustrated by the information given? A An amino acid can be coded for by more than one triplet. B The triplet code is non-overlapping and is only read in one direction. C The triplet code is universal for the DNA of all organisms. D There are some triplets that code for ‘start’ and ‘stop’.

1 marks

Answer: A

This question in 9700/12 Feb/March 2017

Q95 · Some secretory cells synthesise and release glycoproteins 9700/11 May/June 2017

5 Some secretory cells synthesise and release glycoproteins. What is the correct order of the sequence of events as they occur in the secretory cell? 1 exocytosis 2 product accumulates in secretory vesicle 3 mRNA binds to ribosomes 4 synthesis of glycoprotein A 3, 4, 1, 2 B 3, 4, 2, 1 C 4, 3, 1, 2 D 4, 3, 2, 1

1 marks

Answer: B

This question in 9700/11 May/June 2017

Q96 · Which statements about tRNA are correct? 9700/11 May/June 2017

25 Which statements about tRNA are correct? 1 contains base pairing 2 contains hydrogen bonds 3 is single stranded A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: A

This question in 9700/11 May/June 2017

Q97 · Different tissues in a plant were supplied with a radioactively labelled substance to… 9700/12 May/June 2017

19 Different tissues in a plant were supplied with a radioactively labelled substance to identify which tissues were actively synthesising mRNA. Which radioactively labelled substances would be most suitable for this experiment? 1 adenine 2 ribose 3 inorganic phosphate 4 uracil A 1, 2, 3 and 4 B 1, 2 and 3 only C 2 and 4 only D 4 only

1 marks

Answer: C

This question in 9700/12 May/June 2017

Q98 · Electron micrographs may show large numbers of ribosomes forming chains along mRNA… 9700/12 May/June 2017

20 Electron micrographs may show large numbers of ribosomes forming chains along mRNA molecules. What is the advantage of this arrangement, compared to when ribosomes appear singly on the mRNA? A Different polypeptides can be produced simultaneously. B Fewer tRNA molecules are required to translate the polypeptide. C Large polypeptide chains can be produced. D Polypeptides can be produced more rapidly.

1 marks

Answer: D

This question in 9700/12 May/June 2017

Q99 · Which statement is correct? 9700/13 May/June 2017

21 Which statement is correct? A During transcription, mRNA is synthesised from DNA nucleotides to have the same sequence of nucleotides as the DNA strand on which it was made. B During transcription, tRNA is synthesised from RNA nucleotides and carries codons that are complementary to the sequence of nucleotides on the DNA strand on which it was made. C During translation, mRNA is synthesised from RNA nucleotides to have the complementary sequence of nucleotides to that of the DNA strand on which it was made. D During translation, ribosomes join amino acids in a sequence determined by mRNA with the complementary sequence of nucleotides to that of the DNA strand on which it was made.

1 marks

Answer: D

This question in 9700/13 May/June 2017

Q100 · The diagram shows the nucleotide sequence of a small section of a gene which is… 9700/12 Oct/Nov 2017

25 The diagram shows the nucleotide sequence of a small section of a gene which is transcribed. GCGCGCGGCGCG The table shows the amino acids coded for by 10 mRNA codons. mRNA codon amino acid AAG Lys ACG Thr CGG CGC CGU Arg CCG Pro GCC GCG Ala GGC Gly UGC Cys What is the order of the four amino acids in the polypeptide translated from this small section of a gene? A Ala-Ala-Cys-Ala B Ala-Arg-Gly-Ala C Arg-Ala-Pro-Arg D Arg-Arg-Thr-Arg

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2017

Q101 · A cell was supplied with cytosine labelled with radioactive carbon 9700/13 Oct/Nov 2017

3 A cell was supplied with cytosine labelled with radioactive carbon. In which cell structure would radioactivity be detected first? A endoplasmic reticulum B Golgi body C nucleus D ribosome

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2017

Q102 · Rifampicin is an antibiotic used to treat tuberculosis 9700/13 Oct/Nov 2017

23 Rifampicin is an antibiotic used to treat tuberculosis. It works by inhibiting RNA polymerase in bacteria. Which of these processes are prevented by this antibiotic? 1 DNA replication 2 transcription 3 translation A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 3 only

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2017

Q103 · The table shows three anticodons for different amino acids 9700/12 Feb/March 2018

25 The table shows three anticodons for different amino acids. amino acid anticodon alanine CGU histidine GUA serine UCA Which DNA triplet on the DNA template strand codes for the amino acid serine? A AGU B TCA C TGT D UCA

1 marks

Answer: B

This question in 9700/12 Feb/March 2018

Q104 · Radioactively-labelled nucleotides are introduced into a cell 9700/11 May/June 2018

5 Radioactively-labelled nucleotides are introduced into a cell. 1 2 3 4 In which cell structures will the radioactivity first become concentrated? A 1 and 2 B 1 and 4 C 2 and 3 D 3 and 4

1 marks

Answer: C

This question in 9700/11 May/June 2018

Q105 · Which is the correct DNA triplet on the original DNA template that codes for the amino… 9700/11 May/June 2018

23 Which is the correct DNA triplet on the original DNA template that codes for the amino acid histidine (His)? amino acid anticodon Ala CGU His GUA Ser UCA A CAU B CGT C GTA D GUA

1 marks

Answer: C

This question in 9700/11 May/June 2018

Q106 · Which statements about tRNA are correct? 9700/12 May/June 2018

25 Which statements about tRNA are correct? 1 Hydrogen bonds between bases temporarily hold tRNA against mRNA. 2 The base sequences in the tRNA molecules are the same as the base sequences in the mRNA that is being translated. 3 The specificity of the tRNA molecule for glycine and the specificity of the enzyme that loads glycine are both necessary for correct loading. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: C

This question in 9700/12 May/June 2018

Q107 · What occurs during each of DNA replication and transcription and translation? 9700/13 May/June 2018

24 What occurs during each of DNA replication and transcription and translation? 1 ATP provides energy. 2 Condensation reactions occur to form a polymer. 3 Hydrogen bonds form between purine and pyrimidine bases. A 1, 2 and 3 B 1 and 2 only C 2 only D 3 only

1 marks

Answer: A

This question in 9700/13 May/June 2018

Q108 · Part of a sequence of DNA from a person with a genetic disease is: TAGTAACCACAAAGG The… 9700/13 May/June 2018

25 Part of a sequence of DNA from a person with a genetic disease is: TAGTAACCACAAAGG The corresponding sequence of DNA from a person without this genetic disease is: TAGTAAAAACCACAAAGG The possible mRNA codons for some amino acids are shown in the table. amino acid mRNA codons 1 GGU GGC GGA GGG 2 AUU AUC AUA 3 UUU UUC 4 UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? A 1 B 2 C 3 D 4

1 marks

Answer: C

This question in 9700/13 May/June 2018

Q109 · Some antibiotics work by binding to ribosomes 9700/13 May/June 2018

38 Some antibiotics work by binding to ribosomes. Which statement explains why these antibiotics kill bacteria cells but do not kill most human cells? A mRNA in bacteria is formed in the cytoplasm from naked DNA. B The antibiotics cannot pass through human cell membranes. C The codes used for amino acids in bacteria are different from those used by humans. D The ribosomes of bacteria have a different structure from those of humans.

1 marks

Answer: D

This question in 9700/13 May/June 2018

Q110 · Which statements about the primary structure of a protein are correct? 9700/11 Oct/Nov 2018

12 Which statements about the primary structure of a protein are correct? 1 It may be branched. 2 It is determined by the sequence of DNA bases. 3 It is unique to that protein. 4 It determines the tertiary structure of the protein. A 1, 2 and 3 B 1, 2 and 4 C 1, 3 and 4 D 2, 3 and 4

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2018

Q111 · Following translation, the alpha polypeptide chain of haemoglobin, α-globin, undergoes… 9700/11 Oct/Nov 2018

23 Following translation, the alpha polypeptide chain of haemoglobin, α-globin, undergoes modification. During this modification, the first amino acid is removed, leaving 141 amino acid residues. How many nucleotides does the gene coding for α-globin contain? A 141 B 142 C 423 D 426

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2018

Q112 · A length of double-stranded DNA contains 120 nucleotides and codes for a section of a… 9700/13 Oct/Nov 2018

23 A length of double-stranded DNA contains 120 nucleotides and codes for a section of a polypeptide. What is the maximum length of this section of a polypeptide? A 20 amino acids B 40 amino acids C 60 amino acids D 120 amino acids

1 marks

Answer: A

This question in 9700/13 Oct/Nov 2018

Q113 · Ribosomes exist as separate subunits that are bound together during protein synthesis 9700/12 Feb/March 2019

6 Ribosomes exist as separate subunits that are bound together during protein synthesis. What do these subunits consist of? A mRNA and protein B mRNA and tRNA C rRNA and protein D rRNA and tRNA

1 marks

Answer: C

This question in 9700/12 Feb/March 2019

Q114 · Rifampicin is an antibiotic used to treat tuberculosis (TB) 9700/12 Feb/March 2019

22 Rifampicin is an antibiotic used to treat tuberculosis (TB). It works by inhibiting RNA polymerase in bacteria. Which processes are directly inhibited by this antibiotic? 1 DNA replication 2 transcription 3 ATP synthesis A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 only

1 marks

Answer: D

This question in 9700/12 Feb/March 2019

Q115 · In a genetic engineering experiment a piece of double-stranded DNA containing 6000… 9700/11 May/June 2019

24 In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides coding for a specific polypeptide is transcribed and translated. What is the total number of amino acids in this polypeptide? A 500 B 1000 C 2000 D 3000

1 marks

Answer: B

This question in 9700/11 May/June 2019

Q116 · Which statements about tRNA are correct? 9700/11 May/June 2019

25 Which statements about tRNA are correct? 1 Hydrogen bonds between bases temporarily hold tRNA against mRNA. 2 The base sequences in the tRNA molecules are the same as the base sequences in the mRNA that is being translated. 3 tRNA translates the base sequence in mRNA into the amino acid sequence in a protein. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: C

This question in 9700/11 May/June 2019

Q117 · Which statements about complementary base pairing are correct? 9700/12 May/June 2019

19 Which statements about complementary base pairing are correct? 1 It allows translation to occur. 2 Purines and pyrimidines are the same size. 3 The base pairs are of equal length. 4 Uracil forms two hydrogen bonds with adenine. A 1, 2, 3 and 4 B 1, 3 and 4 only C 1 and 4 only D 2 and 3 only

1 marks

Answer: B

This question in 9700/12 May/June 2019

Q118 · The diagram shows part of the DNA sequence of a gene and a mutated sequence of the same… 9700/12 May/June 2019

21 The diagram shows part of the DNA sequence of a gene and a mutated sequence of the same gene. normal DNA sequence ... CCG GAT TAT TGC GAG AAA TGG CAT TCT AGG ... mutated DNA sequence ... CCG GAT GTA TTG CGA GAA ATG CAT TCT AGG ... What are possible effects of the mutated sequence? 1 the presence of mRNA stop codons, UAG, UAA or UGA 2 a change in the sequence of amino acids 3 a non-functional protein 4 ribosomes cannot translate the mRNA A 1, 2 and 3 B 1, 3 and 4 C 1 and 4 only D 2 and 3 only

1 marks

Answer: D

This question in 9700/12 May/June 2019

Q119 · The table shows the DNA triplet codes for some amino acids 9700/13 May/June 2019

28 The table shows the DNA triplet codes for some amino acids. amino acid DNA triplet code amino acid DNA triplet code arginine GCA glycine CCA arginine GCC glycine CCG arginine GCG glycine CCT asparagine TTA lysine TTC asparagine TTG lysine TTT STOP ATC proline GGA cysteine ACA proline GGC cysteine ACG valine CAC The base sequence on the DNA strand coding for a polypeptide is shown. CCA TTC ACG GCG TTA GCA Two mutations occur in this sequence during DNA replication. Which mutated DNA would have no effect on the polypeptide synthesised? A CCA ATC ACG GCG TTG GCA B CCA TTC ACA GCA TTA GCA C CCA TTC ACG CCG TTA GCC D CCT TTC ACG GCG TTA GGA

1 marks

Answer: B

This question in 9700/13 May/June 2019

Q120 · Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the… 9700/11 Oct/Nov 2019

23 Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA CTGACTCCTGAGGAGAAGTCT HbS CTGACTCCTGTGGAGAAGTCT How will the mutation in the allele result in the production of an altered version of the β-globin polypeptide? A A tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA. B All the amino acids coded for after the mutation will differ from those in the HbA protein. C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC. D The ribosome will be unable to continue translation of the HbS mRNA after the altered codon.

1 marks

Answer: A

This question in 9700/11 Oct/Nov 2019

Q121 · Which types of RNA are present in prokaryotic cells and in eukaryotic cells? 9700/12 Oct/Nov 2019

6 Which types of RNA are present in prokaryotic cells and in eukaryotic cells? mRNA rRNA tRNA v v v key v¥ = present 0 0O WwW > v v x x Jv J X = not present x Jv x

1 marks

Answer: A

This question in 9700/12 Oct/Nov 2019

Q122 · The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide 9700/12 Oct/Nov 2019

22 The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide. The diagram shows a strand of DNA which codes for four amino acids. Where would an insertion mutation of a thymine nucleotide result in the termination of translation? T C C A C T C G A T G C A B C D

1 marks

Answer: B

This question in 9700/12 Oct/Nov 2019

Q123 · Three proteins that have a quaternary structure are listed 9700/13 Oct/Nov 2019

9 Three proteins that have a quaternary structure are listed. • Type IX collagen is formed from three different polymers. • The main form of haemoglobin contains two alpha globins and two beta globins. • HIV protease consists of two identical polymers. Which row shows the correct number of genes needed to code for each protein? number of genes type IX HIV haemoglobin collagen protease A 1 2 2 B 1 4 1 C 3 2 1 D 3 4 2

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2019

Q124 · What is the maximum number of codon-anticodon interactions within one ribosome? 9700/13 Oct/Nov 2019

21 What is the maximum number of codon-anticodon interactions within one ribosome? A 2 B 3 C 4 D 6

1 marks

Answer: A

This question in 9700/13 Oct/Nov 2019

Q125 · Which statements about tRNA structure are correct? 9700/13 Oct/Nov 2019

23 Which statements about tRNA structure are correct? 1 There is a binding site for the attachment of a specific amino acid and a different binding site for the attachment to the ribosome, so that translation can occur. 2 There is a ribose-phosphate backbone with strong phosphodiester bonds and areas within the polynucleotide chain where base pairing occurs. 3 There is an anticodon that contains the same triplet of bases as the triplet of DNA bases that has been transcribed to produce the mRNA codon. A 1, 2 and 3 B 1 and 2 only C 1 only D 2 and 3 only

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2019

Q126 · The table shows the tRNA anticodons for four amino acids 9700/12 Feb/March 2020

24 The table shows the tRNA anticodons for four amino acids. amino acid tRNA anticodons asparagine UUA, UUG glutamic acid CUU, CUC proline GGA, GGG, GGU, GGC threonine UGA, UGG, UGU, UGC A cell makes a polypeptide containing the amino acid sequence shown. asparagine – threonine – proline – glutamic acid Which sequence of bases on the transcribed strand of a DNA molecule could code for this part of the polypeptide? A AATACCCCTGAA B AATACCCCTCAA C TTACTTGGATGG D TTATGGGGACTT

1 marks

Answer: D

This question in 9700/12 Feb/March 2020

Q127 · Part of the nucleotide sequence of an mRNA molecule is shown, with spaces between the… 9700/12 May/June 2020

24 Part of the nucleotide sequence of an mRNA molecule is shown, with spaces between the codons. CAG UAC AGC AAU CUA UAA The translation of the codons is provided. amino acid codon or STOP AAU asn AGC ser CAG gln CUA leu UAA STOP UAC tyr UAU tyr Which events will cause the termination of polypeptide synthesis during translation? 1 Deletion of C from the leu codon. 2 Deletion of C from the tyr codon. 3 The ribosome reaching the UAA codon. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: D

This question in 9700/12 May/June 2020

Q128 · The sequence of bases in mRNA for the first eight amino acids in the β-polypeptide of… 9700/13 May/June 2020

22 The sequence of bases in mRNA for the first eight amino acids in the β-polypeptide of adult haemoglobin is: GUG–CAC–CUG–ACU–CCU–GAG–GAG–AAG. In haemoglobin C, which is a cause of haemolytic anaemia, the sequence is: GUG–CAC–CUG–ACU–CCU–AAG–GAG–AAG. The coding for seven of the amino acids is listed. amino acid DNA triplet glu CTC his GTG leu GAG lys TTC pro GGA thr TGA phe AAG Which change occurs to the amino acid sequence of adult haemoglobin to make haemoglobin C? A Histidine is changed to leucine. B Proline is changed to threonine. C Glutamic acid is changed to lysine. D Leucine is changed to phenylalanine.

1 marks

Answer: C

This question in 9700/13 May/June 2020

Q129 · Some antibiotics kill prokaryotes by binding to RNA polymerase 9700/13 May/June 2020

23 Some antibiotics kill prokaryotes by binding to RNA polymerase. What effect will this have on protein synthesis? A Codons on mRNA will be unable to hydrogen bond to complementary anticodons on tRNA. B Condensation reactions joining RNA nucleotides will not take place to form mRNA. C DNA will not unwind and unzip to allow for base pairing with RNA nucleotides. D Free RNA nucleotides will not base pair to exposed bases on the DNA template strand.

1 marks

Answer: B

This question in 9700/13 May/June 2020

Q130 · A molecule of transfer RNA (tRNA) has the anticodon sequence UAC 9700/13 Oct/Nov 2020

24 A molecule of transfer RNA (tRNA) has the anticodon sequence UAC. What will be the corresponding nucleotide sequence in the DNA? A ATG B AUG C TAC D TUG

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2020

Q131 · A piece of double-stranded DNA containing 12  103 nucleotides is transcribed and… 9700/12 Feb/March 2021

21 A piece of double-stranded DNA containing 12  103 nucleotides is transcribed and translated to produce a single polypeptide. What is the maximum number of amino acids in this polypeptide? A 6  103 B 4  103 C 2  103 D 1  103

1 marks

Answer: C

This question in 9700/12 Feb/March 2021

Q132 · The statements describe the process of translation 9700/11 May/June 2021

21 The statements describe the process of translation. 1 A peptide bond forms between adjacent amino acids. 2 Hydrogen bonds form between the anticodon and the codon. 3 mRNA binds to the ribosome. 4 tRNA enters the ribosome carrying a specific amino acid. In which order does this process take place? A 3  2  1  4 B 3  4  2  1 C 4  2  1  3 D 4  2  3  1

1 marks

Answer: B

This question in 9700/11 May/June 2021

Q133 · The sequence of amino acids in a section of a polypeptide is: …… 9700/11 May/June 2021

22 The sequence of amino acids in a section of a polypeptide is: … histidine–proline–aspartic acid–leucine... amino acid possible DNA triplet codes aspartic acid CTA CTG histidine GTA GTG leucine GAT GAC proline GGA GGG What is a correct sequence of mRNA codons for this polypeptide section? A …CAC CCC GAA CUG… B …CAU CCU GAC CUA… C …GTA CCA CTG GAT… D …GUA GGA CUG GAU…

1 marks

Answer: B

This question in 9700/11 May/June 2021

Q134 · Which sequence shows the correct order of some of the stages in the production and… 9700/12 May/June 2021

3 Which sequence shows the correct order of some of the stages in the production and secretion of an enzyme? A Golgi body  ribosome  rough endoplasmic reticulum  mRNA B mRNA  smooth endoplasmic reticulum  Golgi body  vesicle C ribosome  rough endoplasmic reticulum  vesicle  Golgi body D smooth endoplasmic reticulum  mRNA  vesicle  ribosome

1 marks

Answer: C

This question in 9700/12 May/June 2021

Q135 · The diagram shows a strand of DNA and mRNA during transcription 9700/12 May/June 2021

21 The diagram shows a strand of DNA and mRNA during transcription. 1 2 P C G P P G C P 3 Which row correctly identifies 1, 2 and 3? 1 2 3 A purine deoxyribose two hydrogen bonds B purine ribose three hydrogen bonds C pyrimidine deoxyribose two hydrogen bonds D pyrimidine ribose three hydrogen bonds

1 marks

Answer: D

This question in 9700/12 May/June 2021

Q136 · Two students were discussing the involvement of DNA and RNA in transcription and… 9700/12 May/June 2021

22 Two students were discussing the involvement of DNA and RNA in transcription and translation.  Student 1 always stated correct facts.  Student 2 gave further information, which was sometimes correct. correct facts given by student 1 further information given by student 2 1 A length of mRNA is 747 nucleotides This mRNA can produce a polypeptide long, including stop and start codons. that is 249 amino acids long. 2 Adjacent mRNA codons of AAU There is a total of 14 hydrogen bonds and CUG bind to complementary formed between these two codons and tRNA anticodons. their anticodons. 3 RNA polymerase catalyses the formation During translation, an RNA adenine of the mRNA from the template strand nucleotide will pair with a DNA thymine of DNA. nucleotide. 4 A DNA adenine nucleotide is structurally The difference is in the hexose sugars; different to an RNA adenine nucleotide. DNA is deoxyribose and RNA is ribose. Which further information, given by student 2, is correct? A 1 and 4 B 2 and 3 C 2 only D 4 only

1 marks

Answer: C

This question in 9700/12 May/June 2021

Q137 · Some of the events that occur during transcription are listed 9700/13 May/June 2021

21 Some of the events that occur during transcription are listed. 1 Bonds break between complementary bases. 2 Bonds form between complementary bases. 3 Sugar-phosphate bonds form. 4 Free nucleotides pair with complementary nucleotides. Before the mRNA molecule leaves the nucleus, which events occur twice during transcription? A 1, 2 and 3 B 1, 3 and 4 C 2, 3 and 4 D 1 and 2 only

1 marks

Answer: D

This question in 9700/13 May/June 2021

Q138 · The table shows the DNA triplet codes for some amino acids 9700/13 May/June 2021

22 The table shows the DNA triplet codes for some amino acids. amino acid DNA triplet code amino acid DNA triplet code arginine GCA glycine CCA arginine GCC glycine CCG arginine GCG glycine CCT asparagine TTA lysine TTC asparagine TTG lysine TTT cysteine ACA proline GGA cysteine ACG proline GGC STOP ATC valine CAC The base sequence on the DNA template strand coding for part of a polypeptide is shown. CCA TTC ACG GCG TTA GCA Two mutations occur in this sequence during DNA replication. Which mutated DNA would result in a polypeptide with one different amino acid? A CCA ATC ACG GCG TTG GCA B CCA TTC ACA GCA TTA GCA C CCA TTC ACG CCG TTA GCC D CCT TTC ACG GCG TTA GCC

1 marks

Answer: C

This question in 9700/13 May/June 2021

Q139 · A gene codes for the sequence of amino acids in a single polypeptide 9700/13 May/June 2021

23 A gene codes for the sequence of amino acids in a single polypeptide. Haemoglobin consists of two -globins and two -globins. How many genes are needed to code for a single haemoglobin molecule? A 1 B 2 C 4 D 8

1 marks

Answer: B

This question in 9700/13 May/June 2021

Q140 · In which cell structures does DNA transcription occur? 9700/11 Oct/Nov 2021

3 In which cell structures does DNA transcription occur? chloroplast A D mitochondrion nucleus C B

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2021

Q141 · What is the correct tRNA anticodon coding for the amino acid proline? 9700/11 Oct/Nov 2021

24 What is the correct tRNA anticodon coding for the amino acid proline? DNA triplet code amino acid on transcribed strand alanine CGT histidine GTG proline GGT A CCA B CCU C GGT D GGU

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2021

Q142 · The mRNA sequences of the three stop codons are shown 9700/12 Oct/Nov 2021

23 The mRNA sequences of the three stop codons are shown. UAA UAG UGA Which mutation in the template (transcribed) strand of a DNA sequence that codes for a polypeptide would cause translation to stop prematurely? A ATT changed to ATC B ACT changed to ACA C ACC changed to ATT D ATC changed to TAG

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2021

Q143 · When a gene for protease is activated, which nucleic acid will be formed? 9700/13 Oct/Nov 2021

22 When a gene for protease is activated, which nucleic acid will be formed? A DNA B mRNA C rRNA D tRNA

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2021

Q144 · A student sketched a diagram to represent the process of transcription 9700/11 May/June 2022

25 A student sketched a diagram to represent the process of transcription. Which part of their diagram shows the non-transcribed strand? T A A T A G C B C G T U A T U A C C G direction of D A A T transcription C C G G G C G G C T A T A C A T C G

1 marks

Answer: A

This question in 9700/11 May/June 2022

Q145 · Rifampicin is an antibiotic used to treat tuberculosis 9700/12 May/June 2022

22 Rifampicin is an antibiotic used to treat tuberculosis. It works by inhibiting RNA polymerase in bacteria. Which processes are directly inhibited by this antibiotic? 1 DNA replication 2 enzyme synthesis 3 ATP synthesis A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 only

1 marks

Answer: D

This question in 9700/12 May/June 2022

Q146 · The table shows the DNA triplet codes for some amino acids 9700/12 May/June 2022

23 The table shows the DNA triplet codes for some amino acids. amino acid DNA triplet code amino acid DNA triplet code arginine GCA glycine CCA arginine GCC glycine CCG arginine GCG glycine CCT asparagine TTA lysine TTC asparagine TTG lysine TTT cysteine ACA proline GGA cysteine ACG proline GGC STOP ATC valine CAC The base sequence on the template DNA strand coding for part of a polypeptide is shown. CCA ACG GCG TTA TTC GCA Two mutations occur in this sequence during DNA replication. Which mutated template DNA strand would result in a shorter polypeptide? A CCA ACA GCA TTA TTC GCA B CCA ACG CCG TTA TTC GCC C CCA ACG GCG TTG ATC GCA D CCT ACG GCG TTA TTC GGA

1 marks

Answer: C

This question in 9700/12 May/June 2022

Q147 · Which statement about the transcription and translation of a gene is correct? 9700/13 May/June 2022

22 Which statement about the transcription and translation of a gene is correct? A The non-transcribed strand of DNA has a base sequence that is identical to the mRNA produced in transcription. B The template strand of DNA has a base sequence that is identical to the mRNA produced in transcription. C The non-transcribed strand of DNA has a base sequence that is complementary to the tRNA molecules required in translation. D The template strand of DNA has a base sequence that is complementary to the tRNA molecules required in translation.

1 marks

Answer: C

This question in 9700/13 May/June 2022

Q148 · Which statement about mRNA is correct? 9700/13 May/June 2022

23 Which statement about mRNA is correct? A The primary transcript becomes modified by the joining of introns to become mRNA. B The primary transcript is synthesised and then modified to mRNA in the nucleus. C mRNA contains nucleotides containing the sugar deoxyribose. D The bases in mRNA are held together by covalent bonds.

1 marks

Answer: B

This question in 9700/13 May/June 2022

Q149 · The sequence of bases in DNA coding for the first eight amino acids in the -polypeptide… 9700/13 May/June 2022

25 The sequence of bases in DNA coding for the first eight amino acids in the -polypeptide of adult haemoglobin is: CAC GTG GAC TGA GGA CTC CTC TTC However, in haemoglobin C, which is a cause of haemolytic anaemia, it becomes: CAC GTG GAC TGA GGA TTC CTC TTC Some of the DNA triplets that code for the amino acids are listed in the table. amino acid DNA triplet Glu CTC His GTG Leu GAG Lys TTC Pro GGA Thr TGA Which change occurs to the amino acid sequence of normal haemoglobin to make it haemoglobin C? A Glutamic acid is changed to lysine. B Histidine is changed to leucine. C Leucine is changed to lysine. D Proline is changed to threonine.

1 marks

Answer: A

This question in 9700/13 May/June 2022

Q150 · The sequence shows the series of bases at the start of a gene 9700/11 Oct/Nov 2022

24 The sequence shows the series of bases at the start of a gene. TAC CGA CCA CCA CAA CCA CGA... After transcription, the mRNA was translated via tRNA into a sequence of amino acids. When this part of the polypeptide was analysed, it was found to contain the amino acids in the table. amino acid number present Ala 2 Gly 3 Met 1 Val 1 What is the sequence of amino acids in this part of the polypeptide? A Met Ala Gly Ala Gly Gly Val B Met Ala Gly Gly Val Gly Ala C Met Gly Ala Ala Val Ala Gly D Met Gly Ala Ala Gly Gly Val

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2022

Q151 · The table shows the mode of action of two antibacterial drugs that can affect the… 9700/11 Oct/Nov 2022

25 The table shows the mode of action of two antibacterial drugs that can affect the synthesis of proteins. antibacterial rifampicin streptomycin drug mode of binds to RNA causes errors in action polymerase translation If bacteria are treated with the drugs rifampicin and streptomycin, what will be the immediate effects? 1 Transcription will stop but faulty proteins may continue to be synthesised. 2 If translation has started, proteins may be faulty. 3 Translation will be inhibited. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2022

Q152 · A section of the polypeptide coding for the haemoglobin β-chain contains the following… 9700/12 Oct/Nov 2022

23 A section of the polypeptide coding for the haemoglobin β-chain contains the following amino acids. – Pro – Glu – Glu – Patients with sickle cell anaemia have mutated β-polypeptide chains. The section of the mutated polypeptide contains the following amino acids. – Pro – Val – Glu – The table shows the possible anticodons for Val. amino acid anticodon Val C A A Val C A G Val C A C Val C A U What is the corresponding DNA triplet code for the substituted amino acid in the mutated polypeptide? A G T T B G A C C C T C D C A T

1 marks

Answer: D

This question in 9700/12 Oct/Nov 2022

Q153 · Which diagram correctly represents temporary hydrogen bonding during transcription? 9700/12 Oct/Nov 2022

24 Which diagram correctly represents temporary hydrogen bonding during transcription? A B C D A U C G G C T U

1 marks

Answer: B

This question in 9700/12 Oct/Nov 2022

Q154 · The diagram shows part of the DNA sequence of a gene and a mutated sequence of the same… 9700/12 Oct/Nov 2022

25 The diagram shows part of the DNA sequence of a gene and a mutated sequence of the same gene. normal DNA sequence ... CCG GAT TAT TGC GAG AAA TGG CAT TCT AGG ... mutated DNA sequence ... CCG GAT GTA TTG CGA GAA ATG CAT TCT AGG ... What are possible effects of the mutated sequence? 1 the presence of mRNA stop codons, UAG, UAA or UGA 2 a change in the sequence of amino acids 3 a non-functional protein 4 ribosomes cannot translate the mRNA A 1, 2 and 3 B 1, 3 and 4 C 1 and 4 only D 2 and 3 only

1 marks

Answer: D

This question in 9700/12 Oct/Nov 2022

Q155 · Which letter represents cell structures where mRNA may be found? 9700/13 Oct/Nov 2022

3 Which letter represents cell structures where mRNA may be found? cytoplasm A C B mitochondrion nucleus D

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2022

Q156 · Following translation, the alpha polypeptide chain of haemoglobin, α-globin, undergoes… 9700/13 Oct/Nov 2022

25 Following translation, the alpha polypeptide chain of haemoglobin, α-globin, undergoes modification. During this modification, the first amino acid is removed, leaving 141 amino acid residues. How many nucleotides does the mRNA coding for α-globin contain? A 141 B 142 C 423 D 426

1 marks

Answer: D

This question in 9700/13 Oct/Nov 2022

Q157 · Different tissues in a plant were supplied with a radioactively labelled substance to… 9700/12 Feb/March 2023

24 Different tissues in a plant were supplied with a radioactively labelled substance to identify which tissues were actively synthesising mRNA. Which radioactively labelled substances would be suitable for this experiment? 1 adenine 2 uracil 3 inorganic phosphate 4 ribose A 1, 2, 3 and 4 B 1, 2 and 3 only C 2 and 4 only D 4 only

1 marks

Answer: C

This question in 9700/12 Feb/March 2023

Q158 · Which statement about messenger RNA is correct? 9700/11 May/June 2023

19 Which statement about messenger RNA is correct? A In eukaryotic cells, mRNA is made by removing exons from the primary RNA transcript. B mRNA is a single-stranded polynucleotide containing a different purine base than DNA. C mRNA molecules contain ribose sugars joined to phosphate groups by phosphodiester bonds. D The monomers of mRNA contain a phosphate group, deoxyribose sugar and a nitrogenous base.

1 marks

Answer: C

This question in 9700/11 May/June 2023

Q159 · Which structures are involved in transcription only? 9700/11 May/June 2023

20 Which structures are involved in transcription only? DNA template : RNA anticodons strand polymerase A WA J x B J x J Cc x Jv x D x x v key JY = involved X = not involved

1 marks

Answer: B

This question in 9700/11 May/June 2023

Q160 · One gene provides the code for the production of which type of molecule? 9700/11 May/June 2023

21 One gene provides the code for the production of which type of molecule? A amino acid B DNA C nucleotide D polypeptide

1 marks

Answer: D

This question in 9700/11 May/June 2023

Q161 · The table shows some mRNA codons that code for certain amino acids 9700/11 May/June 2023

22 The table shows some mRNA codons that code for certain amino acids. mRNA codon amino acid GCG, GCA, GCC, GCU alanine ACG, ACA, ACC, ACU threonine UGC, UGU cysteine UAC, UAU tyrosine CAG, CAA glutamine CGG, CGA, CGC, CGU arginine A DNA template strand has the base sequence shown. ACAGTATTATTTGCAACG What would the change in the amino acid be if the first base in the fifth DNA triplet was substituted for an A base? A alanine to cysteine B alanine to threonine C arginine to cysteine D arginine to threonine

1 marks

Answer: C

This question in 9700/11 May/June 2023

Q162 · Which cell structures can have mRNA inside them? 9700/12 May/June 2023

3 Which cell structures can have mRNA inside them? 1 chloroplast 2 mitochondrion 3 nucleus 4 rough endoplasmic reticulum A 1, 2, 3 and 4 B 1, 2 and 3 only C 2, 3 and 4 only D 3 and 4 only

1 marks

Answer: B

This question in 9700/12 May/June 2023

Q163 · One characteristic of DNA is that it is a universal genetic code 9700/12 May/June 2023

22 One characteristic of DNA is that it is a universal genetic code. What is meant by a universal genetic code? A All living organisms use the same triplet code for amino acids. B All DNA triplets code for a different amino acid. C Not all DNA triplets code for an amino acid. D All living organisms contain the same four nucleic acids.

1 marks

Answer: A

This question in 9700/12 May/June 2023

Q164 · Which statement about mRNA is correct? 9700/12 May/June 2023

23 Which statement about mRNA is correct? A It is a polymer made of nucleotides all joined with hydrogen bonds. B Each nucleotide subunit contains the sugar ribose. C It always has an equal proportion of adenine and uracil. D The mRNA sequence is identical to the template strand of DNA.

1 marks

Answer: B

This question in 9700/12 May/June 2023

Q165 · The diagram shows part of the process of translation 9700/12 May/June 2023

24 The diagram shows part of the process of translation. Z X Y What are the names of the structures labelled X, Y and Z? X Y Z A anticodon codon mRNA B anticodon codon tRNA C codon anticodon mRNA D codon anticodon tRNA

1 marks

Answer: B

This question in 9700/12 May/June 2023

Q166 · The DNA triplets of genes are translated as amino acids or stop signals during protein… 9700/12 May/June 2023

25 The DNA triplets of genes are translated as amino acids or stop signals during protein synthesis. The table shows some of these triplets. name of DNA triplet amino acid ATA tyrosine ATG tyrosine ACA cysteine ACG cysteine ATC stop signal ACC tryptophan What could be the effects of one substitution mutation in a triplet coding for tyrosine? 1 The triplet is translated as cysteine. 2 The triplet is translated as tryptophan. 3 The triplet is translated as tyrosine. 4 Translation stops at this triplet. A 1, 2 and 3 B 1, 2 and 4 C 1, 3 and 4 D 2, 3 and 4

1 marks

Answer: C

This question in 9700/12 May/June 2023

Q167 · The diagram shows the process of translation occurring at a ribosome 9700/13 May/June 2023

26 The diagram shows the process of translation occurring at a ribosome. ribosome S C A U U C G C U A A U G What is the base sequence at S? A CUA B CAT C GAU D GAT

1 marks

Answer: C

This question in 9700/13 May/June 2023

Q168 · The RNA codon wheel is a tool used to find which amino acid would be translated from an… 9700/12 Oct/Nov 2023

23 The RNA codon wheel is a tool used to find which amino acid would be translated from an mRNA sequence. Gly Phe Leu Glu Asp Ser CUAG CU AG AG CUAG UC Tyr Ala UCAG G U UC Stop A C AG C A Cys UCAG UC Val Stop U G U G A G Trp Arg AG G UCAG A C U UC Leu Ser A C AG UCAG Lys UC C A U G Pro Asn CUAG CU AG G CUAG His Thr ACU Gln Met Arg Ile Codon position 1 is in the centre of the wheel, codon position 2 is in the middle of the wheel and codon position 3 is near the edge of the wheel. The three letters on the outside edge of the wheel identify the amino acid. The diagram shows a section of DNA coding for one amino acid. The template strand is outlined in a box and the DNA base sequence is read in the 5′ to 3′ direction. template strand Which amino acid is coded for by this section of DNA? A Gly B Pro C Trp D Thr

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2023

Q169 · Which processes occur in eukaryotes and prokaryotes? 9700/13 Oct/Nov 2023

7 Which processes occur in eukaryotes and prokaryotes? 1 hydrolysis 2 mitosis 3 transcription 4 translation A 1, 2 and 3 B 1, 2 and 4 C 1, 3 and 4 D 2, 3 and 4

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2023

Q170 · The genome of the bacterium Escherichia coli has been altered to enable it to code for an… 9700/13 Oct/Nov 2023

23 The genome of the bacterium Escherichia coli has been altered to enable it to code for an amino acid that is not found in nature. All the ATC DNA stop triplets on the strand of DNA that is transcribed have been substituted to ATT. The ATC triplet can then be inserted to code for the new amino acid. A new tRNA can then be constructed to carry the new amino acid. What is the anticodon of this new tRNA? A ATC B AUC C TAG D UAG

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2023

Q171 · 40% of the bases in a section of a non-transcribed strand of DNA are purine molecules 9700/13 Oct/Nov 2023

24 40% of the bases in a section of a non-transcribed strand of DNA are purine molecules. What will be the total percentage of cytosine and uracil bases in the primary transcript that is transcribed from the other strand of the DNA? A 20% B 30% C 40% D 60%

1 marks

Answer: D

This question in 9700/13 Oct/Nov 2023

Q172 · Some vaccines do not contain antigens 9700/13 Oct/Nov 2023

40 Some vaccines do not contain antigens. The vaccines contain a molecule of mRNA. Cells in the immune system use the mRNA molecule to make a protein antigen. The statements describe the stages of how mRNA vaccines work when they enter a cell of the immune system. 1 B-lymphocytes and T-lymphocytes with complementary receptors bind to the protein. 2 Lymphocytes differentiate into memory cells that give long lasting immunity. 3 Ribosomes translate the mRNA molecule to make a protein. 4 The cell displays the protein on its cell surface membrane. What is the correct order of the stages of how mRNA vaccines work? A 1 → 2 → 4 → 3 B 3 → 1 → 2 → 4 C 3 → 4 → 1 → 2 D 4 → 1 → 2 → 3

1 marks

Answer: C

This question in 9700/13 Oct/Nov 2023

Q173 · Which statements about complementary base pairing are correct? 9700/12 Feb/March 2024

25 Which statements about complementary base pairing are correct? 1 Purines and pyrimidines are different sizes. 2 Complementary base pairing occurs during translation. 3 The base pairs are of different lengths. 4 Uracil forms two hydrogen bonds with adenine. A 1, 2 and 3 B 1, 2 and 4 C 1, 3 and 4 D 2, 3 and 4

1 marks

Answer: B

This question in 9700/12 Feb/March 2024

Q174 · Which molecule has its synthesis directly controlled by DNA? 9700/12 Feb/March 2024

27 Which molecule has its synthesis directly controlled by DNA? A amylase B cholesterol C glycogen D phospholipid

1 marks

Answer: A

This question in 9700/12 Feb/March 2024

Q175 · What is the correct order of locations in the cell for the production of an extracellular… 9700/11 May/June 2024

10 What is the correct order of locations in the cell for the production of an extracellular enzyme? A nucleus  ribosome  rough endoplasmic reticulum  Golgi body B ribosome  nucleus  Golgi body  rough endoplasmic reticulum C ribosome  rough endoplasmic reticulum  nucleus  Golgi body D rough endoplasmic reticulum  nucleus  Golgi body  ribosome

1 marks

Answer: A

This question in 9700/11 May/June 2024

Q176 · The diagram shows the nucleotide sequence of a small section of the transcribed strand of… 9700/11 May/June 2024

22 The diagram shows the nucleotide sequence of a small section of the transcribed strand of a gene. CGG GCC CCG CGG The table shows the amino acids coded for by 10 mRNA codons. mRNA codon amino acid AAG Lys ACG Thr CGG CGC CGU Arg CCG Pro GCC GCG Ala GGC Gly UGC Cys What is the sequence of the four amino acids in the polypeptide translated from this small section of a gene? A Ala-Ala-Cys-Ala B Ala-Arg-Gly-Ala C Arg-Ala-Pro-Arg D Arg-Arg-Thr-Arg

1 marks

Answer: B

This question in 9700/11 May/June 2024

Q177 · What does the process of translation require? 9700/11 May/June 2024

23 What does the process of translation require? A DNA, free nucleotide bases and mRNA B DNA, mRNA, amino acids and RNA polymerase C mRNA, ribosomes and RNA polymerase D mRNA, ribosomes, amino acids and tRNA

1 marks

Answer: D

This question in 9700/11 May/June 2024

Q178 · Which statements about peptide bond formation are correct? 9700/12 May/June 2024

7 Which statements about peptide bond formation are correct? 1 The bond formation occurs between a carbon of one amino acid and a nitrogen of the next amino acid after the amino acids detach from tRNA. 2 The bond formation occurs at the ribosome while the amino acids are still attached to tRNA, and is a hydrolysis reaction. 3 The bond formation is important for growth of an organism and when the bond forms, a water molecule is removed. A 1 and 3 B 2 and 3 C 2 only D 3 only

1 marks

Answer: D

This question in 9700/12 May/June 2024

Q179 · The mRNA codons ACU, ACC, ACA and ACG all code for the same amino acid, threonine 9700/12 May/June 2024

21 The mRNA codons ACU, ACC, ACA and ACG all code for the same amino acid, threonine. Which anticodons could specify an amino acid other than threonine? 1 UCA 2 ACC 3 UGU 4 UGC A 1, 3 and 4 B 1 and 2 C 2 and 3 D 3 and 4 only

1 marks

Answer: B

This question in 9700/12 May/June 2024

Q180 · In eukaryotes, the RNA molecules formed during transcription are modified by the removal… 9700/12 May/June 2024

23 In eukaryotes, the RNA molecules formed during transcription are modified by the removal of non-coding sequences. This is followed by the joining together of coding sequences to form mRNA. What are the coding sequences also called? A codons B exons C introns D primary transcripts

1 marks

Answer: B

This question in 9700/12 May/June 2024

Q181 · A transcription error results in the deletion of one nucleotide from the middle of a… 9700/13 May/June 2024

22 A transcription error results in the deletion of one nucleotide from the middle of a primary transcript. mRNA forms from the primary transcript. Which statement describes one possible effect of this deletion on the protein translated from this mRNA? A The protein will be unchanged as the same amino acids can be coded by another codon formed by the deletion. B The tertiary structure of the protein is not affected as only one amino acid has been changed by the deletion. C Only one amino acid has been changed by the deletion but this changes the quaternary structure of the protein. D The sequence of amino acids in the protein will be different as all the codons from the deletion onwards are changed.

1 marks

Answer: D

This question in 9700/13 May/June 2024

Q182 · Which statements correctly describe the process of translation? 9700/13 May/June 2024

23 Which statements correctly describe the process of translation? 1 The nucleotide sequence on an mRNA molecule is used to produce a specific amino acid chain. 2 A section of DNA is copied into an mRNA molecule by RNA polymerase. 3 A polypeptide is produced because anticodons on tRNA molecules attach to mRNA codons through peptide bonds. A 1 and 2 B 1 and 3 C 1 only D 2 and 3

1 marks

Answer: C

This question in 9700/13 May/June 2024

Q183 · A molecule of mRNA was used in translation 9700/13 May/June 2024

24 A molecule of mRNA was used in translation. Part of its sequence is shown. GAU CUG UAA CGG There were no introns present in the section of DNA that was transcribed to make this mRNA. What is the sequence of the non-transcribed DNA strand for this section? A CTA GAC ATT GCC B CUA GAC AUU GCC C GAT CTG TAA CGG D GAU CUG UAA CGG

1 marks

Answer: C

This question in 9700/13 May/June 2024

Q184 · Which statement explains why lymphocytes with no nucleoli die? 9700/11 Oct/Nov 2024

2 Which statement explains why lymphocytes with no nucleoli die? A The cells do not have centrioles and cannot divide. B The cells do not have mitochondria and cannot release energy. C The cells do not have mRNA and cannot transcribe DNA. D The cells do not have ribosomes and cannot synthesise protein.

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2024

Q185 · The statements describe processes that take place in a secretory cell 9700/11 Oct/Nov 2024

5 The statements describe processes that take place in a secretory cell. 1 Modification of the protein occurs in the Golgi body. 2 mRNA leaves the nucleus. 3 Ribosomes bind to mRNA during translation. 4 Transcription of a specific DNA sequence occurs. 5 Vesicles fuse with the cell surface membrane. 6 Vesicles transport the protein to the Golgi body. Statement 4 is the first process, and statement 5 is the last process. What is the correct sequence of the middle four processes? A 2  3  1  6 B 2  3  6  1 C 3  2  1  6 D 3  2  6  1

1 marks

Answer: B

This question in 9700/11 Oct/Nov 2024

Q186 · Which statements describe how a gene mutation can lead to the production of a… 9700/11 Oct/Nov 2024

23 Which statements describe how a gene mutation can lead to the production of a non-functional protein? 1 During transcription, an incorrect nucleotide is added to a DNA molecule. 2 The mutated gene results in a new codon being transcribed. 3 The order of the bases in an anticodon on tRNA is altered during translation. A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 2 only

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2024

Q187 · The diagram shows the nucleotide sequence of a small section of the transcribed strand of… 9700/11 Oct/Nov 2024

25 The diagram shows the nucleotide sequence of a small section of the transcribed strand of a gene. GCG CGC GGC GCG The table shows the amino acids coded for by 10 mRNA codons. mRNA codon amino acid AAG Lys ACG Thr CGG CGC CGU Arg CCG Pro GCC GCG Ala GGC Gly UGC Cys What is the sequence of the four amino acids in the polypeptide translated from this small section of a gene? A Ala-Ala-Cys-Ala B Ala-Arg-Gly-Ala C Arg-Ala-Pro-Arg D Arg-Arg-Thr-Arg

1 marks

Answer: C

This question in 9700/11 Oct/Nov 2024

Q188 · Which processes occur in bone marrow cells that are in a mitotic cell cycle? 9700/12 Oct/Nov 2024

20 Which processes occur in bone marrow cells that are in a mitotic cell cycle? 1 Phosphate groups bind to ADP molecules to form ATP. 2 Bonds form between nucleotides in a DNA strand. 3 Hydrogen bonds form between tRNA anticodons and mRNA codons. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 only

1 marks

Answer: A

This question in 9700/12 Oct/Nov 2024

Q189 · A polypeptide molecule contains the amino acid sequence: glycine – leucine – lysine… 9700/12 Oct/Nov 2024

22 A polypeptide molecule contains the amino acid sequence: glycine – leucine – lysine – valine. The table shows DNA triplets for these amino acids. glycine leucine lysine valine CCC GAA TTT CAA Which tRNA anticodons are needed for the synthesis of this polypeptide? A CCC GAA TTT CAA B CCC GAA UUU CAA C GGG CUU AAA GUU D GGG CUU UUU GUU

1 marks

Answer: B

This question in 9700/12 Oct/Nov 2024

Q190 · During the production of protein molecules, only one strand from the DNA double helix is… 9700/12 Oct/Nov 2024

25 During the production of protein molecules, only one strand from the DNA double helix is used. Which name is given to the DNA strand that is used to produce a new protein? A non-transcribed strand B leading strand C template strand D lagging strand

1 marks

Answer: C

This question in 9700/12 Oct/Nov 2024

Q191 · Which strand of DNA does RNA polymerase bind to? 9700/13 Oct/Nov 2024

23 Which strand of DNA does RNA polymerase bind to? A lagging strand B leading strand C non-transcribed strand D template strand

1 marks

Answer: D

This question in 9700/13 Oct/Nov 2024

Q192 · Which processes occur during the formation of messenger RNA? 9700/13 Oct/Nov 2024

24 Which processes occur during the formation of messenger RNA? 1 condensation 2 polymerisation 3 replication 4 transcription A 1, 2 and 3 B 1, 2 and 4 C 1, 3 and 4 D 2, 3 and 4

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2024

Q193 · The anticodon for the amino acid tryptophan is ACC 9700/13 Oct/Nov 2024

25 The anticodon for the amino acid tryptophan is ACC. What shows a template DNA sequence that includes the DNA triplet for tryptophan? A UGG CGU CCG B GCU GAC ACG C CTT TGG ATG D CCT ACC CAT

1 marks

Answer: D

This question in 9700/13 Oct/Nov 2024

Q194 · The diagram represents the process of transcription of a gene in the nucleus of an animal… 9700/12 Feb/March 2025

25 The diagram represents the process of transcription of a gene in the nucleus of an animal cell. P Q RNA polymerase R Which row correctly identifies P, Q and R? P Q R A mRNA transcribed strand template strand B primary transcript transcribed strand template strand C mRNA template strand non-transcribed strand D primary transcript template strand non-transcribed strand

1 marks

Answer: D

This question in 9700/12 Feb/March 2025

Q195 · The table shows all the possible DNA triplet codes for some amino acids 9700/12 May/June 2025

25 The table shows all the possible DNA triplet codes for some amino acids. DNA triplet amino acid code cysteine ACA cysteine ACG tryptophan ACC isoleucine TAA isoleucine TAG isoleucine TAT methionine TAC The amino acid sequence is shown. methionine – isoleucine – cysteine – tryptophan What is the maximum number of different DNA sequences that could produce this amino acid sequence? A 1 B 4 C 6 D 7

1 marks

Answer: C

This question in 9700/12 May/June 2025

Q196 · Which cell structures contain ribosomal RNA? 9700/13 May/June 2025

4 Which cell structures contain ribosomal RNA? 1 chloroplasts 2 mitochondria 3 nuclei A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 3 only

1 marks

Answer: A

This question in 9700/13 May/June 2025

Q197 · Which statements about tRNA are correct? 9700/13 May/June 2025

23 Which statements about tRNA are correct? 1 Hydrogen bonds between bases temporarily bond tRNA to mRNA. 2 The base sequences in the tRNA molecules are the same as the base sequences in the mRNA that is being translated. 3 Some codons in mRNA do not have corresponding tRNA anticodons. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

1 marks

Answer: C

This question in 9700/13 May/June 2025

Q198 · Why is the genetic code described as universal? 9700/13 May/June 2025

24 Why is the genetic code described as universal? A Each codon is made up of a sequence of three bases. B More than one codon can represent one amino acid. C Mutations can change the genetic code in all organisms. D The genetic code is the same in all organisms.

1 marks

Answer: D

This question in 9700/13 May/June 2025

Q199 · Three proteins that have a quaternary structure are listed 9700/13 May/June 2025

26 Three proteins that have a quaternary structure are listed. ● Type IX collagen is formed from three different polymers. ● The main form of haemoglobin contains two alpha globins and two beta globins. ● HIV protease consists of two identical polymers. Which row shows the correct number of genes needed to code for each protein? number of genes type IX HIV haemoglobin collagen protease A 1 2 2 B 1 4 1 C 3 2 1 D 3 4 2

1 marks

Answer: C

This question in 9700/13 May/June 2025

Q200 · How many genes could code for one collagen molecule? 9700/14 May/June 2025

25 How many genes could code for one collagen molecule? A 1 gene only B 2 genes only C 3 genes only D 1 gene or 2 genes or 3 genes

1 marks

Answer: D

This question in 9700/14 May/June 2025

Q201 · The diagram shows some events during the formation of an mRNA molecule at transcription 9700/14 May/June 2025

26 The diagram shows some events during the formation of an mRNA molecule at transcription. P 5′ 3′ Q Q S R What is correctly identified in the diagram? A P are introns. B Q are exons. C R is a primary transcript. D S are non-coding sequences.

1 marks

Answer: D

This question in 9700/14 May/June 2025

Q202 · The gene that codes for protein R is 130 kb long 9700/11 Oct/Nov 2025

22 The gene that codes for protein R is 130 kb long. Protein R is 220 kDa in mass. The typical mass of an amino acid is 110 Da. (1000 base pairs = 1 kb, 1000 Da = 1 kDa) Which row is correct? approximate length approximate length of introns in this of mRNA for this gene / base pairs gene / base pairs A 6000 6000 B 6000 130 000 C 124 000 6000 D 124 000 130 000

1 marks

Answer: C

This question in 9700/11 Oct/Nov 2025

Q203 · The table shows some of the DNA triplet codes for some amino acids 9700/11 Oct/Nov 2025

25 The table shows some of the DNA triplet codes for some amino acids. amino acid DNA triplet code amino acid DNA triplet code arginine GCA glycine CCA arginine GCC glycine CCG arginine GCG glycine CCT asparagine TTA lysine TTC asparagine TTG lysine TTT cysteine ACA proline GGA cysteine ACG proline GGC STOP ATC valine CAC The base sequence on the template DNA strand coding for part of a polypeptide is shown. CCA TTC ACG GCG TTA GCA Two mutations occur in this sequence during DNA replication. Which mutated DNA would result in two different amino acids? A CCA ATC ACG GCG TTG GCA B CCA TTC ACA GCA TTA GCA C CCA TTC ACG CCG TTA GCC D CCA TTC ACG GCG TTC GGA

1 marks

Answer: D

This question in 9700/11 Oct/Nov 2025

Q204 · Which statements about complementary base pairing are correct? 9700/13 Oct/Nov 2025

25 Which statements about complementary base pairing are correct? 1 It occurs during translation. 2 Purines and pyrimidines are the same size. 3 The base pairs are of equal length. 4 Uracil forms three hydrogen bonds with adenine. A 1 and 2 B 1 and 3 C 2 and 3 D 3 and 4

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2025

Q205 · Which statement is correct for protein synthesis? 9700/13 Oct/Nov 2025

26 Which statement is correct for protein synthesis? A During translation, the strand of DNA used is the template strand. B mRNA is formed when introns are removed from the primary transcript. C The DNA primary transcript is modified by removing exons. D tRNA has codons which attach to anticodons on the mRNA.

1 marks

Answer: B

This question in 9700/13 Oct/Nov 2025

Q206 · A mutation occurred in this original DNA nucleotide sequence 9700/13 Oct/Nov 2025

27 A mutation occurred in this original DNA nucleotide sequence. C T A G A A T C C T C T C C C After the mutation occurred, the new DNA nucleotide sequence coded for the amino acids Asp, Leu, Gly and Glu. The table shows the amino acids that are coded for by each DNA triplet. 2nd base A G T C AAA Phe AGA Ser ATA Tyr ACA Cys AAG Phe AGG Ser ATG Tyr ACG Cys A AAT Leu AGT Ser ATT Stop ACT Stop AAC Leu AGC Ser ATC Stop ACC Trp GAA Leu GGA Pro GTA His GCA Arg GAG Leu GGG Pro GTG His GCG Arg G GAT Leu GGT Pro GTT Gln GCT Arg GAC Leu GGC Pro GTC Gln GCC Arg 1st base TAA Ile TGA Thr TTA Asn TCA Ser TAG Ile TGG Thr TTG Asn TCG Ser T TAT Ile TGT Thr TTT Lys TCT Arg TAC Met TGC Thr TTC Lys TCC Arg CAA Val CGA Ala CTA Asp CCA Gly CAG Val CGG Ala CTG Asp CCG Gly C CAT Val CGT Ala CTT Glu CCT Gly CAC Val CGC Ala CTC Glu CCC Gly Which type of gene mutation occurred in the DNA nucleotide sequence? A deletion of one nucleotide B insertion of one nucleotide C insertion of two nucleotides D substitution of one nucleotide

1 marks

Answer: A

This question in 9700/13 Oct/Nov 2025