Cambridge A Level Biology 9700 — 2019 Oct/Nov Paper 1 · Variant 1

Question 1

1 Which cell structure contains cytoplasm? A chloroplasts B mitochondria C plasmodesmata D smooth endoplasmic reticulum

Accepted Answer

C

Question 2

2 Some cell structures are listed in a particular order. 1 nucleus 2 ribosome 3 Golgi body 4 vesicle What determines the order in which these cell structures are listed? A sequence used in synthesis of a lipid B sequence used in synthesis of an antibody C size from largest to smallest D size from smallest to largest

Accepted Answer

B

Question 3

3 The drawing has been made from a section showing part of an alveolus and a red blood cell in a capillary. The magnification of the drawing is ×5000. alveolus red blood cell What is the minimum distance that oxygen must diffuse from air in an alveolus into the red blood cell? A 0.1 nm B 1.0 nm C 0.1 µm D 1.0 µm

Accepted Answer

D

Question 4

4 Four students were asked to match the function with the appearance of some cell structures in an animal cell. The functions were listed by a number. 1 mRNA passes through to the ribosome 2 synthesis of polypeptides 3 packaging of hydrolytic enzymes that will remain in the cell The appearances were listed by a letter. V membranes which surround an enclosed inner cavity W non-membrane bound, spherical structures X a double membrane interspersed with pores Y non-membrane bound, cylindrical structures Z membrane-bound sacs, arranged as a flattened stack Which student correctly matched the numbered functions with the appearance of the cell structure? 1 2 3 A V X Y B V Z Z C X W Z D X Z W

Accepted Answer

C

Question 5

5 The antibiotic chloramphenicol inhibits protein synthesis in mitochondria and in some prokaryotes. Chloramphenicol does not inhibit protein synthesis in the cytoplasm of eukaryotic cells. What would be the effect on the cells of a person being treated with chloramphenicol? rate of ATP production transcription of nuclear DNA A decreases decreases B decreases no effect C increases decreases D no effect no effect

Accepted Answer

A

Question 6

6 The diagram shows the monosaccharide xylose. H H C O OH H C H C OH HO C C H H OH Many xylose monomers can be joined by glycosidic bonds to form a polysaccharide which is found in plant cell walls. Which diagram shows the formation of a glycosidic bond between two xylose monomers? H H H C O OH H C O OH H H A C H C C H C OH OH HO C C H HO C C H H OH H OH H H H C O OH H C O OH H H B C H C C H C OH OH HO C C H HO C C H H OH H OH H H OH H C O OH HO C C H H OH H C C C C C OH H H HO C C H H C O OH H OH H H H OH H C O OH HO C C H H OH H D C C C C OH H H HO C C H H C O OH H OH H

Accepted Answer

D

Question 7

7 Which colour indicates the lowest concentration of reducing sugar present in a solution after testing with Benedict’s solution? A brown B green C red D yellow

Accepted Answer

B

Question 8

8 Which molecules are monomers? 1 ribose 2 glucose 3 deoxyribose 4 sucrose A 1, 2 and 3 B 1, 2 and 4 C 1, 3 and 4 D 2, 3 and 4

Accepted Answer

A

Question 9

9 Which molecules have properties that are dependent on hydrogen bonds? 1 cellulose 2 glycogen 3 haemoglobin 4 water A 1, 2 and 3 B 1, 2 and 4 C 1, 3 and 4 D 2, 3 and 4

Accepted Answer

C

Question 10

10 Some features of triglycerides are listed. 1 can be liquid or solid at room temperature 2 contains a high proportion of carbon–hydrogen bonds 3 insoluble in water 4 less dense than water Which of these features make triglycerides suitable energy stores? A 1 and 2 B 1 and 4 C 2, 3 and 4 D 2 and 3 only

Accepted Answer

D

Question 11

11 Some foods contain hydrogenated vegetable oils. These are unsaturated fats that have been converted to saturated fats. Which property of the fats will have changed? A Their hydrocarbon chains will fit together more closely. B Their solubility in water will increase. C They will have more double bonds in their molecules. D They will remain liquid at room temperature.

Accepted Answer

A

Question 12

12 Which statements could be used to describe enzyme molecules and antibody molecules? 1 Hydrogen bonds stabilise the structure of the protein and are important for it to function efficiently. 2 Hydrophilic R-groups point in to the centre of the molecule and cause it to curl into a spherical shape. 3 The tertiary structure of the protein molecule plays an important role in the functioning of the protein. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

Accepted Answer

C

Question 13

13 The Vmax and Km are determined for an enzyme-catalysed reaction. What will be the effects on the Vmax and Km in the presence of a competitive inhibitor? Vmax Km A decreases increases B increases decreases C stays the same decreases D stays the same increases

Accepted Answer

D

Question 14

14 The graph shows how the concentration of components,1, 2, 3 and 4, of an enzyme-catalysed reaction changes with time. 1 concentration 2 3 4 time Which row identifies the components of this reaction? component 1 component 2 component 3 component 4 A enzyme–substrate unbound enzyme product substrate complex B enzyme–substrate product substrate unbound enzyme complex C product enzyme–substrate unbound enzyme substrate complex D product unbound enzyme substrate enzyme–substrate complex

Accepted Answer

D

Question 15

15 Which statement suggests that a membrane protein is involved in active transport? A It allows movement of molecules across a membrane if concentration differences exist. B It can only function if mitochondria are supplied with sufficient oxygen. C It has a tertiary structure with a binding site with a specific shape. D It is found in the cell surface membranes and the mitochondrial membranes.

Accepted Answer

B

Question 16

16 Cell surface receptors used in cell signalling are usually proteins that extend from one side of the membrane to the other side of the membrane. What is the role of the extracellular part of the protein? A binding the signalling molecule B functioning as an enzyme C increasing the solubility of the receptor D transmitting the signal from the target cell

Accepted Answer

A

Question 17

17 Which substances can pass directly through cell surface membranes and do not use a carrier protein or channel protein? 1 K+ and Cl – 2 CO2 3 C6H12O6 A 1 and 2 B 1 and 3 C 2 and 3 D 2 only

Accepted Answer

D

Question 18

18 A student put a layer of plant epidermal cells on a microscope slide. The student put a drop of potassium nitrate solution on the layer of cells and observed that: • the cell surface membrane of many of the cells had separated from the cell wall • the cytoplasm and cell contents had shrunk. What explains these observations? direction of net water water potential of cells water potential of movement at start / kPa solution at start / kPa A cells to solution –100 –500 B cells to solution –500 –100 C solution to cells –100 –500 D solution to cells –500 –100

Accepted Answer

A

Question 19

19 The enzyme telomerase prevents loss of telomeres after many mitotic cell cycles. Which cells transcribe a high concentration of telomerase? 1 neutrophils 2 mature red blood cells 3 activated memory T-lymphocytes A 1 and 2 B 1 and 3 only C 1 only D 3 only

Accepted Answer

D

Question 20

20 At which stage of mitosis do these events occur? chromosomes become centromeres separate shorter and thicker A anaphase interphase B anaphase prophase C metaphase interphase D metaphase prophase

Accepted Answer

B

Question 21

21 Which components could be found in nucleotides of rRNA? 1 any one of two different nitrogenous bases with a double ring structure 2 any one of two different purine bases 3 any one of three different nitrogenous bases with a single ring structure 4 any one of three different pyrimidine bases A 1, 2, 3 and 4 B 1 and 2 only C 1 and 4 only D 3 and 4 only

Accepted Answer

B

Question 22

22 How many statements are true for semi-conservative replication of DNA in a prokaryotic cell? 1 the process takes place in the cytoplasm 2 an adenine nucleotide will line up against a uracil on the template strand 3 each new DNA molecule will contain one strand from the parent molecule 4 if the parent molecule contained 40% guanine nucleotides each new DNA molecule will contain 20% guanine nucleotides A 1 B 2 C 3 D 4

Accepted Answer

B

Question 23

23 Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA CTGACTCCTGAGGAGAAGTCT HbS CTGACTCCTGTGGAGAAGTCT How will the mutation in the allele result in the production of an altered version of the β-globin polypeptide? A A tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA. B All the amino acids coded for after the mutation will differ from those in the HbA protein. C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC. D The ribosome will be unable to continue translation of the HbS mRNA after the altered codon.

Accepted Answer

A

Question 24

24 The diagrams show some tissue types in plant organs. 1 2 4 3 Which row identifies the tissue types? 1 2 3 4 A phloem phloem phloem xylem B phloem xylem phloem xylem C xylem phloem xylem phloem D xylem xylem phloem xylem

Accepted Answer

A

Question 25

25 Which row correctly describes the adaptations of companion cells, phloem sieve tube elements and xylem vessel elements for their roles? companion cell phloem sieve tube element xylem vessel element A a thin layer of cytoplasm strong, lignified cell walls many plasmodesmata to reduce resistance to flow for supporting the plant for communication between cells B empty cells allowing many plasmodesmata strong, lignified cell walls water to flow freely for communication for supporting the plant between cells C many plasmodesmata a thin layer of cytoplasm empty cells allowing for communication to reduce resistance to flow water to flow freely between cells D strong, lignified cell walls empty cells allowing a thin layer of cytoplasm for supporting the plant water to flow freely to reduce resistance to flow

Accepted Answer

C

Question 26

26 Irrigating crop plants with water containing low concentrations of salt causes an increase in the concentration of salt in the soil. What explains why the increase in salt concentration could eventually kill the crop? water potential water potential direction of water in roots in soil movement A decreases out of the roots B increases into the roots C decreases out of the roots D increases into the roots

Accepted Answer

C

Question 27

27 The diagram shows the pathway of water across root cells to the xylem. Which cell is in the endodermis? A B C D xylem

Accepted Answer

C

Question 28

28 Which row shows the cause of mass flow in the phloem and the direction of movement of phloem sap by mass flow? cause of mass flow direction of movement in the phloem of phloem sap by mass flow A hydrostatic pressure gradient sink to source B hydrostatic pressure gradient source to sink C water potential gradient sink to source D water potential gradient source to sink

Accepted Answer

B

Question 29

29 Which statement about oxygen combining with haemoglobin is correct? A All oxygen molecules which combine stop the haemoglobin molecule changing shape. B Four oxygen molecules can combine with each haem group. C The first oxygen molecule to combine does not affect the shape of haemoglobin. D The second oxygen molecule to combine makes it easier for the third to combine.

Accepted Answer

D

Question 30

30 The diagram shows the Bohr effect. 100 80 X percentage 60 saturation of haemoglobin Y with oxygen 40 20 0 0 2 4 6 8 10 partial pressure of oxygen / kPa What causes the shift from X to Y? A decreased concentration of carbon dioxide and high pH B decreased concentration of carbon dioxide and low pH C increased concentration of carbon dioxide and high pH D increased concentration of carbon dioxide and low pH

Accepted Answer

D

Question 31

31 Which plan diagram represents the tissues in a major vein? A B C D

Accepted Answer

D

Question 32

32 Ventricular septal defect (VSD) is a heart defect that people can have from birth. People with VSD have a hole in the wall (septum) that separates the left and right ventricles. What could happen in a person with VSD? 1 Blood will leak through the hole, mostly from right to left. 2 The volume of blood circulating through the lungs will be higher than in a person without VSD. 3 Less oxygen will be delivered to the body tissues. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

Accepted Answer

D

Question 33

33 The diagram shows the pressure changes in some structures of the right side of the heart during the cardiac cycle. pressure X / kPa 0 0 0.2 0.4 0.6 0.8 time / s Which structure is represented by X? A pulmonary artery B right atrium C right ventricle D vena cava

Accepted Answer

A

Question 34

34 The diagram shows a section through a type of epithelium.

Where is this type of epithelium found in the respiratory system?

trachea bronchus all bronchioles
A J J Jv
B Jv v x
Cc v x JV
D x v JV

key
v¥ = present

X = not present

Accepted Answer

B

Question 35

35 In chronic obstructive pulmonary disease (COPD), airflow through the airways is reduced. Which statements explain the reduced airflow? 1 More mucus is secreted into the airways. 2 Airways and alveoli lose their elasticity. 3 Many of the alveoli are destroyed. 4 Carbon monoxide binds irreversibly to haemoglobin. A 1, 2, 3 and 4 B 1, 2 and 3 only C 1, 3 and 4 only D 2, 3 and 4 only

Accepted Answer

B

Question 36

36 Outbreaks of cholera commonly occur in refugee camps that are set up after a major natural disaster such as earthquakes. The list shows some measures that can be taken to limit the spread of cholera in the refugee camps. 1 treating all drinking water supplies with a high concentration of chlorine 2 setting up an emergency treatment centre to isolate cases of cholera and treat them with antibiotics 3 using concentrated disinfectant to clean sewage disposal areas and infected bedding 4 health workers visiting regularly to detect cases 5 keeping good records of the number of cases and deaths at treatment centres Which features of these control measures involve an economic factor? A 1, 2, 3, 4 and 5 B 1, 3 and 5 only C 2, 3, 4 and 5 only D 2 and 4 only

Accepted Answer

A

Question 37

37 Which use of antibiotics helps to reduce the spread of resistance in bacteria? A using high concentrations of the antibiotic to kill all the bacteria B giving routine preventative antibiotics to people who are having an operation C regularly changing the type of antibiotic used to treat particular bacterial infections D giving antibiotics to treat low level infection caused by a bacterium

Accepted Answer

C

Question 38

38 The graph shows the amount of antibody produced in response to an antigen. concentration of antibody in the blood 0 10 20 30 40 time in days first exposure to an antigen From the graph, which statement is correct? A It takes 25 days to achieve active immunity. B Memory cells for this antigen are present in the body within 20 days. C T-helper lymphocytes are activated on day 12. D The second exposure to the antigen occurred on day 25.

Accepted Answer

B

Question 39

39 Which sequence summarises the hybridoma method for the production of monoclonal antibodies? A B C D inject mammal inject mammal inject mammal inject mammal with antibodies with antibodies with antigens with antigens ↓ ↓ ↓ ↓ harvest harvest harvest harvest antibodies B-lymphocytes antibodies B-lymphocytes from blood from spleen from blood from spleen ↓ ↓ ↓ ↓ test for fuse with test for fuse with wanted antibody cancer cells wanted antibody cancer cells ↓ ↓ ↓ ↓ fuse with test for fuse with test for cancer cells wanted antibody cancer cells wanted antibody ↓ ↓ ↓ ↓ large scale large scale large scale large scale culture culture culture culture

Accepted Answer

D

Question 40

40 The vaccination programme for smallpox was a medical success story which resulted in the World Health Organisation finally declaring the world free from smallpox in 1980. Which statement correctly identifies the reasons for the success of the smallpox vaccination programme? A The virus also infected animals making it easy to stop the transmission cycle. B The virus remained in the body following infection and could become active later. C The virus was stable and not prone to mutations. D The virus was unstable and prone to mutations.

Accepted Answer

C

Question paper20 pages

Mark scheme3 pages

Questions as text

Q1 · Which cell structure contains cytoplasm?

Q2 · Some cell structures are listed in a particular order

Q3 · The drawing has been made from a section showing part of an alveolus and a red blood cell…

Q4 · Four students were asked to match the function with the appearance of some cell…

Q5 · The antibiotic chloramphenicol inhibits protein synthesis in mitochondria and in some…

Q6 · The diagram shows the monosaccharide xylose

Q7 · Which colour indicates the lowest concentration of reducing sugar present in a solution…

Q8 · Which molecules are monomers?

Q9 · Which molecules have properties that are dependent on hydrogen bonds?

Q10 · Some features of triglycerides are listed

Q11 · Some foods contain hydrogenated vegetable oils

Q12 · Which statements could be used to describe enzyme molecules and antibody molecules?

Q13 · The Vmax and Km are determined for an enzyme-catalysed reaction

Q14 · The graph shows how the concentration of components,1, 2, 3 and 4, of an enzyme-catalysed…

Q15 · Which statement suggests that a membrane protein is involved in active transport?

Q16 · Cell surface receptors used in cell signalling are usually proteins that extend from one…

Q17 · Which substances can pass directly through cell surface membranes and do not use a…

Q18 · A student put a layer of plant epidermal cells on a microscope slide

Q19 · The enzyme telomerase prevents loss of telomeres after many mitotic cell cycles

Q20 · At which stage of mitosis do these events occur?

Q21 · Which components could be found in nucleotides of rRNA?

Q22 · How many statements are true for semi-conservative replication of DNA in a prokaryotic…

Q23 · Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the…

Q24 · The diagrams show some tissue types in plant organs

Q25 · Which row correctly describes the adaptations of companion cells, phloem sieve tube…

Q26 · Irrigating crop plants with water containing low concentrations of salt causes an…

Q27 · The diagram shows the pathway of water across root cells to the xylem

Q28 · Which row shows the cause of mass flow in the phloem and the direction of movement of…

Q29 · Which statement about oxygen combining with haemoglobin is correct?

Q30 · The diagram shows the Bohr effect

Q31 · Which plan diagram represents the tissues in a major vein?

Q32 · Ventricular septal defect (VSD) is a heart defect that people can have from birth

Q33 · The diagram shows the pressure changes in some structures of the right side of the heart…

Q34 · The diagram shows a section through a type of epithelium

Q35 · In chronic obstructive pulmonary disease (COPD), airflow through the airways is reduced

Q36 · Outbreaks of cholera commonly occur in refugee camps that are set up after a major…

Q37 · Which use of antibiotics helps to reduce the spread of resistance in bacteria?

Q38 · The graph shows the amount of antibody produced in response to an antigen

Q39 · Which sequence summarises the hybridoma method for the production of monoclonal…

Q40 · The vaccination programme for smallpox was a medical success story which resulted in the…

What was in this paper

What you needed in this session

Other variants, same session

This paper, other years