Cambridge A Level Biology 9700 — 2015 May/June Paper 1 · Variant 3

Question 1

1 What are found in both mitochondria and typical prokaryotic cells? A 70S ribosomes and circular DNA B 70S ribosomes only C 80S ribosomes and circular DNA D circular DNA only

Accepted Answer

A

Question 2

2 Which statements about light microscopes are correct? 1 To calculate the magnification of a light microscope the eyepiece lens and objective lens magnifications are added together. 2 As the magnification increases the resolution decreases. 3 The resolution of a light microscope is limited by the wavelength of light. 4 The scale on a stage micrometer is resolved more clearly than an eyepiece graticule. A 1, 2, 3 and 4 B 1, 3 and 4 only C 2 and 3 only D 2 and 4 only

Accepted Answer

C

Question 3

3 Which comparison of a phloem companion cell with a B-lymphocyte is correct? A Both cell types have proteins embedded in their cell surface membranes. B B-lymphocytes have a spherical nucleus but companion cells do not have a nucleus. C Companion cells always contain chloroplasts, which are not present in B-lymphocytes. D Neither B-lymphocytes nor companion cells possess plasmodesmata.

Accepted Answer

A

Question 4

4 Ribosomes exist as separate subunits that bind together during protein synthesis. What do these subunits consist of? A mRNA and protein B mRNA and tRNA C rRNA and protein D rRNA and tRNA

Accepted Answer

C

Question 5

5 Which structures in plant cells have a double membrane? A chloroplasts and vacuoles B lysosomes and nuclei C mitochondria and vacuoles D nuclei and mitochondria

Accepted Answer

D

Question 6

6 What is the diameter of a typical prokaryote, such as Streptococcus? A 7.5 × 101 nm B 7.5 × 102 nm C 7.5 × 100 µm D 7.5 × 101 µm

Accepted Answer

B

Question 7

7 Which molecule is α-glucose? A B C D CH2OH CH2OH CH2OH O O HOCH2 O CH2OH O OH OH H OH H H H H H OH H OH H H H OH OH OH H H H OH H OH OH H OH H OH OH H H OH

Accepted Answer

D

Question 8

8 The diagram shows the three dimensional structure of collagen. Which labelled part represents a molecule of collagen? C B D A

Accepted Answer

C

Question 9

9 Which type of bond does not hold together the tertiary structure of a protein? A disulfide B hydrogen C hydrophobic interactions D peptide

Accepted Answer

D

Question 10

10 Which properties of water are a result of only cohesion? 1 The water has a high surface tension. 2 Water moves up xylem vessels. 3 Water is an excellent solvent. A 1, 2 and 3 B 1 and 2 only C 1 only D 3 only

Accepted Answer

C

Question 11

11 The protein glutenin gives bread dough its elasticity. The diagram represents a polypeptide of glutenin. tightly tightly coiled coiled region region loose spiral What describes the structure of glutenin? A quaternary structure because there are both globular and fibrous regions B quaternary structure because there are both spiral and tightly coiled regions C secondary structure because the loose spiral is an α-helix D tertiary structure because the different regions form a 3D shape

Accepted Answer

D

Question 12

12 A student carried out four tests for biological molecules. The observations are shown in the table. test observations iodine orange biuret purple Benedict’s orange emulsion clear Which molecules are present in the solution? 1 2 H OH HO CH2 C C H OH CH2OH H O O N C H H C C O O HO C CH2 C C H OH H H C C C C O H OH H H N C O O C C H H CH3 C C H CH2OH H OH O N H H 3 4 H O CH2OH H C O C R C O O H H H C C H C O C R OH H HO OH O C C H OH H C O C R H A 1 and 2 B 1 and 3 C 2 and 3 D 3 and 4

Accepted Answer

B

Question 13

13 Some inhibitors of enzyme reactions bind to the enzyme-substrate complex. Which statements about this type of inhibition are correct? 1 The active site changes shape. 2 The inhibitor is non-competitive. 3 The initial rate of reaction is reduced. 4 The maximum rate of reaction (Vmax) stays the same. A 2, 3 and 4 B 1 and 2 C 1 and 3 D 2 and 3 only

Accepted Answer

D

Question 14

14 The enzyme DNA polymerase is used in DNA replication. This enzyme was extracted from bacteria living in natural hot water springs where the water temperature is between 85 °C and 95 °C. Which graph would represent the relationship between temperature and the rate of DNA replication when catalysed by the enzyme from these bacteria? A B rate of rate of reaction reaction 0 0 10 60 10 60 temperature / °C temperature / °C C D rate of rate of reaction reaction 0 0 10 60 10 60 temperature / °C temperature / °C

Accepted Answer

C

Question 15

15 What supports the view that a membrane protein is involved in active transport? A It allows movement of molecules across a membrane if concentration differences exist. B It can only function if mitochondria are supplied with sufficient oxygen. C It has a tertiary structure with a binding site with a specific shape. D It is found in the cell surface membranes and the mitochondrial membranes.

Accepted Answer

B

Question 16

16 The graph shows the effect of increasing the concentration of glucose in a solution on the rate of entry of glucose into a cell. X rate of entry of glucose into the cell 00 concentration of glucose in solution What are not causes of the plateau at X? 1 All the carrier proteins are saturated with glucose. 2 The carrier proteins are denatured and no longer able to function. 3 The cell has used up its supply of ATP. 4 The concentrations of glucose inside and outside the cell are equal. A 1, 2 and 4 B 2, 3 and 4 C 2 and 3 only D 1 only

Accepted Answer

B

Question 17

17 Which set of factors will produce the least fluid cell surface membrane? an increase in A • proportion of short fatty acid chains • distance between phospholipid molecules B • proportion of long fatty acid chains • proportion of phospholipids with saturated fatty acid chains C • proportion of short fatty acid chains • proportion of phospholipids with unsaturated fatty acid chains D • proportion of phospholipids with unsaturated fatty acid chains • temperature

Accepted Answer

B

Question 18

18 The diagrams show chromosomes at different stages of mitosis. W X Y Z Which shows the correct order of the cell cycle? A W → X → Y → Z B X → Y → Z → W C Y → Z → W → X D Z → W → X → Y

Accepted Answer

B

Question 19

19 Which diagrams show the correct relationships? conservation increase in DNA A of chromosome mitosis 2n        n chromosome 2n        4n replication number number increase in reduction in DNA B chromosome 2n        2n chromosome meiosis 2n        n replication number number increase in reduction in DNA C chromosome n        2n chromosome mitosis 2n        n replication number number reduction in conservation D chromosome meiosis 2n        n of chromosome mitosis 2n        2n number number

Accepted Answer

D

Question 20

20 Which row correctly describes adenine? component on complementary nucleotide strand ring structure base it is attached to A thymine deoxyribose double B thymine phosphate single C uracil phosphate double D uracil ribose single

Accepted Answer

A

Question 21

21 Which row shows two pairs of nucleotides formed when mRNA is translated? first base pair translated second base pair translated number of number of bases present bases present hydrogen bonds hydrogen bonds A AT 2 TU 2 B AU 2 AT 2 C AU 2 GC 3 D AU 3 GC 3

Accepted Answer

C

Question 22

22 Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA CTGACTCCTGAGGAGAAGTCT HbS CTGACTCCTGTGGAGAAGTCT How will the mutation in the HbS allele result in the production of an altered version of the β-globin polypeptide? A A tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA. B All the amino acids coded for after the mutation will differ from those in the HbA protein. C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC. D The ribosome will be unable to continue translation of the HbS mRNA after the altered codon.

Accepted Answer

A

Question 23

23 Which force holds water molecules on the surface of cell walls? A adhesion B capillarity C cohesion D surface tension

Accepted Answer

A

Question 24

24 The statements are about the properties of water. 1 requires a lot of heat to evaporate 2 holds a lot of heat 3 is able to form hydrogen bonds with other water molecules 4 is able to form hydrogen bonds with other polar molecules Which properties are important for translocation in phloem? A 1 and 2 B 1 and 3 C 2 and 3 D 3 and 4

Accepted Answer

D

Question 25

25 Which changes to the water potential and the volume of liquid in the phloem occur when amino acids are moved into a phloem sieve tube at a source? water potential volume of liquid in phloem sieve in phloem sieve tubes tubes A higher decreased B higher increased C lower decreased D lower increased

Accepted Answer

D

Question 26

26 Which feature of transport in xylem depends on the use of energy? A mass flow of water to the leaves B osmosis of water into xylem C uptake of ions into the root D transpiration of water from the leaves

Accepted Answer

C

Question 27

27 What is correct about the transport of carbon dioxide by blood? 1 The enzyme carbonic anhydrase catalyses the formation of carbonic acid in red blood cells. 2 Carbon dioxide diffuses from respiring cells to red blood cells and reacts with water. 3 Carbonic acid dissociates forming hydrogen ions that combine with haemoglobin to form carbaminoglobin. A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 3 only

Accepted Answer

B

Question 28

28 The graph shows the effect of different partial pressures of carbon dioxide (CO2) on the oxygen dissociation curve for haemoglobin. 100 80 partial pressure CO partial pressure CO2 partial pressure CO2 1.0 1.0 kPa 1.0 kPa kPa 60 percentage partial pressure CO2 partial pressure CO partial pressure CO2 saturation of 1.5 1.5 kPa 1.5 kPa kPa haemoglobin with oxygen 40 20 0 0 1 2 3 4 5 6 7 8 9 10 11 12 partial pressure of oxygen / kPa What is the change in percentage oxygen saturation of haemoglobin at a partial pressure of oxygen of 6 kPa as the partial pressure of carbon dioxide changes from 1.0 kPa to 1.5 kPa? A –26% B –20% C 20% D 46%

Accepted Answer

B

Question 29

29 Which structures transport deoxygenated blood? 1 4 2 3 A 1 and 2 B 2 and 4 C 3 and 4 D 3 only

Accepted Answer

C

Question 30

30 Which effect could be due to a reduced concentration of carbonic anhydrase? A carbaminohaemoglobin concentrations will decrease B less oxygen is released from oxyhaemoglobin in respiring tissues C the pH of the blood will be lowered D the rate of dissociation of carbonic acid is increased

Accepted Answer

B

Question 31

31

Which row identifies the effects on the body of nicotine in tobacco smoke?

reduces the
diameter of small

increases the

. combines with
secretion of

haemoglobin

arteries (arterioles) adrenaline
A v v v key
B v v x ¥ = true
Cc v x v X = false
D x v v

Accepted Answer

B

Question 32

32 Lung cancer and chronic obstructive pulmonary disease (COPD) share a number of common symptoms. Which symptom is typical of lung cancer and not COPD? A coughing up blood B mucus production increases C persistent cough that does not go away D wheezing (difficulty breathing)

Accepted Answer

A

Question 33

33 A person breathes in small particles from a very dusty environment. What effect will this have on B-lymphocytes and goblet cells? B-lymphocytes goblet cells A less active more active B less active no change C more active more active D no change less active

Accepted Answer

C

Question 34

34 The diagram shows properties of diseases. What shows the properties that are common to both tuberculosis (TB) and measles? bacterial A infectious B C D transmitted by airborne droplets

Accepted Answer

D

Question 35

35 Strains of Mycobacterium have been found that are: • multiple drug-resistant (MDR) – resistant to the drugs most commonly used to control tuberculosis (TB) • extensively drug-resistant (XDR) – resistant to the drugs most commonly used to control TB and to some of the drugs less commonly used to control TB • totally drug-resistant (TDR) – resistant to all known drugs used to control TB. Comparisons of some of these strains of Mycobacterium found differences in the thickness of their cell walls, as shown in the table. thickness of cell Mycobacterium wall / nm non-resistant 15 MDR 17 TDR 20 What conclusions may be drawn from this information? A Bacteria secrete thicker cell walls when in contact with a mixture of drugs. B The cell walls of TDR bacteria are impermeable to drugs. C Thicker cell walls may form a physical barrier to drugs. D XDR bacteria have cell walls between 17 and 20 nm thick.

Accepted Answer

C

Question 36

36 What describes natural passive immunity? A protection against a pathogen by an injection of antibodies B protection against a pathogen by drinking colostrum containing antibodies C stimulation of lymphocytes by antigens contained in a vaccine D stimulation of lymphocytes by antigens on the surface of invading pathogens

Accepted Answer

B

Question 37

37 What happens when people are injected with dead bacteria? A B-lymphocytes produce antibodies. B B-lymphocytes produce antigens. C T-lymphocytes produce antibodies. D T-lymphocytes produce antigens.

Accepted Answer

A

Question 38

38 The diagram represents part of the nitrogen cycle. Which process is carried out by nitrifying bacteria? nitrogen in atmosphere A D ammonia C B nitrogen compounds nitrogen compounds nitrogen compounds in soil in plants in animals

Accepted Answer

C

Question 39

39 A primary consumer, X, is lost from a community due to a lethal viral infection. After a time, the size of the populations of some of the organisms shown in the food web changed. Which population of organisms increased? A B C D primary consumer X primary producer

Accepted Answer

C

Question 40

40 The table shows the results of a field study of four species in a food chain in an area of woodland. energy value per number of biomass of one species unit mass individuals individual / arbitrary units / arbitrary units P 10 000 0.100 1.0 Q 5 10.000 2.0 R 500 0.002 1.8 S 3 300 000.000 0.5 Which is the correct pyramid of energy from these data? A B R S Q Q P R S P C D S R P P R Q Q S

Accepted Answer

A

Question paper16 pages

Mark scheme2 pages

Questions as text

Q1 · What are found in both mitochondria and typical prokaryotic cells?

Q2 · Which statements about light microscopes are correct?

Q3 · Which comparison of a phloem companion cell with a B-lymphocyte is correct?

Q4 · Ribosomes exist as separate subunits that bind together during protein synthesis

Q5 · Which structures in plant cells have a double membrane?

Q6 · What is the diameter of a typical prokaryote, such as Streptococcus?

Q7 · Which molecule is α-glucose?

Q8 · The diagram shows the three dimensional structure of collagen

Q9 · Which type of bond does not hold together the tertiary structure of a protein?

Q10 · Which properties of water are a result of only cohesion?

Q11 · The protein glutenin gives bread dough its elasticity

Q12 · A student carried out four tests for biological molecules

Q13 · Some inhibitors of enzyme reactions bind to the enzyme-substrate complex

Q14 · The enzyme DNA polymerase is used in DNA replication

Q15 · What supports the view that a membrane protein is involved in active transport?

Q16 · The graph shows the effect of increasing the concentration of glucose in a solution on…

Q17 · Which set of factors will produce the least fluid cell surface membrane?

Q18 · The diagrams show chromosomes at different stages of mitosis

Q19 · Which diagrams show the correct relationships?

Q20 · Which row correctly describes adenine?

Q21 · Which row shows two pairs of nucleotides formed when mRNA is translated?

Q22 · Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the…

Q23 · Which force holds water molecules on the surface of cell walls?

Q24 · The statements are about the properties of water

Q25 · Which changes to the water potential and the volume of liquid in the phloem occur when…

Q26 · Which feature of transport in xylem depends on the use of energy?

Q27 · What is correct about the transport of carbon dioxide by blood?

Q28 · The graph shows the effect of different partial pressures of carbon dioxide (CO2) on the…

Q29 · Which structures transport deoxygenated blood?

Q30 · Which effect could be due to a reduced concentration of carbonic anhydrase?

Q31 · Which row identifies the effects on the body of nicotine in tobacco smoke?

Q32 · Lung cancer and chronic obstructive pulmonary disease (COPD) share a number of common…

Q33 · A person breathes in small particles from a very dusty environment

Q34 · The diagram shows properties of diseases

Q35 · Strains of Mycobacterium have been found that are: • multiple drug-resistant (MDR)…

Q36 · What describes natural passive immunity?

Q37 · What happens when people are injected with dead bacteria?

Q38 · The diagram represents part of the nitrogen cycle

Q39 · A primary consumer, X, is lost from a community due to a lethal viral infection

Q40 · The table shows the results of a field study of four species in a food chain in an area…

What was in this paper

What you needed in this session

Other variants, same session

This paper, other years