Cambridge A Level Biology 9700 — 2023 Oct/Nov Paper 1 · Variant 1

This document has 20 pages. Any blank pages are indicated. IB23 11_9700_11/3RP © UCLES 2023 [Turn over *3346162285* Cambridge International AS & A Level BIOLOGY 9700/11 Paper 1 Multiple Choice October/November 2023 1 hour 15 minutes You must answer on the multiple choice answer sheet. You will need: Multiple choice answer sheet Soft clean eraser Soft pencil (type B or HB is recommended) INSTRUCTIONS • There are forty questions on this paper. Answer all questions. • For each question there are four possible answers A, B, C and D. Choose the one you consider correct and record your choice in soft pencil on the multiple choice answer sheet. • Follow the instructions on the multiple choice answer sheet. • Write in soft pencil. • Write your name, centre number and candidate number on the multiple choice answer sheet in the spaces provided unless this has been done for you. • Do not use correction fluid. • Do not write on any bar codes. • You may use a calculator. INFORMATION • The total mark for this paper is 40. • Each correct answer will score one mark. • Any rough working should be done on this question paper.

2 © UCLES 2023 9700/11/O/N/23 1 Until recently, the typical viruses known to science were 20–150 nm in size. In 2003, the Mimivirus was discovered with a size of approximately 680 nm. In 2013, the Pandoravirus was discovered which has a size of over 1000 nm. Which viruses can be seen using a light microscope with a maximum resolution of 0.25 µm and an electron microscope? typical virus Mimivirus Pandoravirus A    key B     = can be seen C     = cannot be seen D    2 The diagram shows an eyepiece graticule and a cell viewed through a microscope. When the eyepiece graticule was calibrated at this magnification, the whole length of the graticule shown covered 12 divisions of a stage micrometer scale. There were 100 divisions in 10 mm of the stage micrometer. 0 10 20 30 40 50 60 70 80 90 100 What is the actual length of the cell? A 2.5 µm B 3.6 µm C 360 µm D 3 mm

3 © UCLES 2023 9700/11/O/N/23 [Turn over 3 Tay-Sachs disease results in a build-up of lipids in cells. Which cell structure does not function correctly in this disease? A Golgi body B lysosome C mitochondrion D smooth endoplasmic reticulum 4 Which animal cells would have the most extensive Golgi bodies? A ciliated epithelial cells B goblet cells C red blood cells D smooth muscle cells 5 The diagram shows three circles, 1, 3 and 5, and the shared structures, 2 and 4. circle 1 2 circle 3 4 circle 5 Which row correctly identifies the three circles and some of the structures that are shared between them? circle 1 2 circle 3 4 circle 5 A chloroplasts circular DNA mitochondria 80S ribosomes prokaryotes B chloroplasts 80S ribosomes mitochondria circular DNA prokaryotes C prokaryotes circular DNA mitochondria circular DNA chloroplasts D prokaryotes 70S ribosomes chloroplasts 80S ribosomes mitochondria

4 © UCLES 2023 9700/11/O/N/23 6 Which row about the genetic material in animal cells and prokaryotic cells is correct? animal cells contain linear DNA prokaryotic genetic material is surrounded by a double membrane prokaryotic genetic material is double-stranded DNA A    key B     = correct C     = not correct D    7 What is present in all viruses? A uracil B ribose C thymine D guanine 8 The test for non-reducing sugars requires a second Benedict’s test to be carried out. Which set of steps is the correct method for carrying out the non-reducing sugar test before carrying out the second Benedict’s test? A Perform the Benedict’s test, which gives a negative result. Warm gently with dilute hydrochloric acid. Neutralise with sodium hydrogencarbonate. B Perform the Benedict’s test, with the colour of the solution remaining red. Boil with dilute hydrochloric acid. Neutralise with sodium hydrogencarbonate. C Perform the Benedict’s test, with the colour of the solution remaining blue. Boil with dilute hydrochloric acid. Neutralise with sodium hydrogencarbonate. D Perform the Benedict’s test, which gives a negative result. Neutralise with sodium hydrogencarbonate. Warm gently with dilute hydrochloric acid.

5 © UCLES 2023 9700/11/O/N/23 [Turn over 9 The diagrams show three types of covalent bonds. O C C O O H H H 1 O C C 2 N C 3 Which bonds will be found in glycolipids and glycoproteins? bond 1 bond 2 bond 3 A glycolipids only glycolipids and glycoproteins glycoproteins only B glycolipids and glycoproteins glycolipids only glycoproteins only C glycoproteins only glycolipids only glycolipids and glycoproteins D glycoproteins only glycolipids and glycoproteins glycolipids only

6 © UCLES 2023 9700/11/O/N/23 10 Which molecules would be found in an oil (liquid) more than in a fat (solid)? H2C O C O (CH2)12 HC O C O (CH2)14 H2C O C O (CH2)7CH=CH(CH2)7 H2C O C O (CH2)14 HC O C O (CH2)7CH=CH(CH2)7 H2C O C O (CH2)7CH=CHCH2CH=CH(CH2)4 1 H2C O C O (CH2)16 CH3 CH3 HC O C O (CH2)16 CH3 (CH2)16 H2C O C O H2C O C O (CH2)14 CH3 CH3 HC O C O (CH2)14 CH3 CH3 CH3 CH3 CH3 CH3 CH3 (CH2)14 H2C O C O 2 3 4 A 1 and 3 B 1 and 4 C 2 and 3 D 2 and 4 11 Which row about the bonding found in the primary, secondary, tertiary and quaternary structure of proteins is correct? primary secondary tertiary quaternary A covalent covalent ionic and disulfide only hydrogen and hydrophobic interactions only B covalent hydrogen hydrogen, ionic, covalent and hydrophobic interactions hydrogen, ionic, covalent and hydrophobic interactions C peptide covalent hydrogen, ionic, disulfide and hydrophobic interactions hydrogen, ionic and disulfide D peptide hydrogen ionic and disulfide only ionic and disulfide only

7 © UCLES 2023 9700/11/O/N/23 [Turn over 12 The specific heat capacity of different substances is shown. substance specific heat capacity / J g–1 °C air 1.0 hydrogen gas 14.3 water (liquid) 4.2 water (steam) 2.1 Which statement is correct? A Air is a more stable environment than water because it is more resistant to changes in temperature. B It takes more energy to raise the temperature of hydrogen gas than it does to raise the temperature of water. C A specific heat capacity of 4.2 J g–1 °C means that it takes 4.2 J of energy to vaporise 1.0 g of liquid water. D There are more hydrogen bonds between water molecules in a gas than between water molecules in a liquid. 13 The solid line on the graph represents the product formed over time for a reaction in a cell. Which other line represents the effect of adding the enzyme for this reaction? total product formed time B D C A

8 © UCLES 2023 9700/11/O/N/23 14 The graph shows how the rate of an enzyme-controlled reaction is affected by the change in temperature. All other variables were standardised. rate of reaction temperature region X What is the factor limiting the rate in region X? A substrate concentration B enzyme concentration C temperature D number of empty active sites 15 How will the removal of a reversible non-competitive enzyme inhibitor affect an enzyme-catalysed reaction? A The Km will decrease and the Vmax will increase. B The Km will increase and the Vmax will not change. C The Km will not change and the Vmax will increase. D The Km will not change and the Vmax will not change. 16 The dimensions of three agar cylinders, X, Y and Z, are summarised in the table. cylinder radius / mm length / mm X 2 10 Y 1 20 Z 5 5 What is the correct order of surface area : volume ratio for the cylinders, from smallest to largest? A X → Y → Z B Y → X → Z C Z → X → Y D Z → Y → X

9 © UCLES 2023 9700/11/O/N/23 [Turn over 17 Three individual plant leaf cells were each placed in a different solution for 30 minutes. Each solution had a different water potential. Which row correctly shows the change in volume of the three cells after 30 minutes? water potential of solution lower than cells equal to cells higher than cells A decreased increased decreased B decreased no change increased C increased decreased decreased D increased no change increased 18 Which row is a representation of one chromosome at the beginning of prophase of mitosis and the number of DNA strands in the chromosome? appearance of one chromosome number of DNA strands A 2 B 4 C 1 D 2 19 Which events are part of mitosis? 1 interphase 2 telophase 3 cytokinesis A 1, 2 and 3 B 1 and 3 only C 2 and 3 only D 2 only

10 © UCLES 2023 9700/11/O/N/23 20 The statements are about genes and proteins involved in breast cancer. ● The protein coded by the BRAC1 gene inhibits the growth of breast cancer cells. ● The protein coded by the p53 gene suppresses tumours. Which combination of genes is most likely to result in breast cancer? BRAC1 p53 A   key B    = normal active gene C    = mutated gene D   21 The photomicrograph shows a cell during mitosis. What is happening in this cell? 1 Chromosomes are condensing. 2 Centromeres are moving to opposite poles. 3 Spindle microtubules are shortening. A 1 and 2 B 1 and 3 C 2 and 3 D 3 only

11 © UCLES 2023 9700/11/O/N/23 [Turn over 22 Which diagram correctly shows the structure of a piece of DNA? G P P A P C P U C U G A P P P P A A P P C P T P C T G A G P P P P B A P P T P T P C C G G A P P P P C C P P G P T P C G C A G P P P P D

12 © UCLES 2023 9700/11/O/N/23 23 Bacteria were grown in a medium containing 15N. After several generations, all of the bacterial DNA contained 15N. Some of these bacteria were transferred to a medium containing the common isotope of nitrogen, 14N. The bacteria were allowed to divide once. The DNA of some of these bacteria was extracted and analysed. This DNA was all hybrid DNA containing equal amounts of 14N and 15N. The remaining bacteria were left in the medium with 14N and allowed to divide one more time. The DNA of some of these bacteria was extracted and analysed. What is the percentage of hybrid DNA? A 25% hybrid DNA B 50% hybrid DNA C 75% hybrid DNA D 100% hybrid DNA 24 Which statements correctly describe the process of transcription? 1 mRNA is decoded by a ribosome to produce a specific amino acid chain. 2 A section of DNA is converted to RNA by RNA polymerase. 3 tRNA transfers amino acids to the ribosome. A 1 and 3 B 1 only C 2 and 3 D 2 only 25 Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram shows the sequence of bases in a small section of the template strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA CTGACTCCTGAGGAGAAGTCT HbS CTGACTCCTGTGGAGAAGTCT Both the polypeptides for HbA and HbS are the same length. How will the mutation in the allele result in the production of an altered version of the β-globin polypeptide? A A tRNA molecule with the anticodon GUG will form hydrogen bonds with the altered codon on mRNA. B All the amino acids coded for after the mutation will differ from those in the HbA protein. C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC. D The ribosome will be unable to continue translation of the HbS mRNA after the altered codon.

13 © UCLES 2023 9700/11/O/N/23 [Turn over 26 The plan diagram of a transverse section through a dicotyledonous plant stem was drawn by a student. They had stained the section with a chemical that stains lignin. W Z Which row is correct for tissues W and Z? W Z stained tissue A phloem xylem W B phloem xylem Z C xylem phloem W D xylem phloem Z 27 Which routes must water travel through in a plant, using the symplast pathway? 1 from soil into root hair cell vacuoles 2 from soil into root hair cell walls 3 from root hair cell walls to root cortex cell walls 4 from cortex cell walls into endodermis cells 5 from endodermis cells into xylem vessels 6 from leaf mesophyll cell walls into air spaces A 1 and 4 B 2, 3 and 6 C 3, 5 and 6 D 4 and 5

14 © UCLES 2023 9700/11/O/N/23 28 A plant leaf seen in transverse section with a microscope shows the features listed. ● a thick waxy cuticle on upper surface ● sunken stomata on lower surface ● rolled leaf so the edges curl What is this leaf adapted for? A to decrease carbon dioxide uptake B to increase carbon dioxide uptake C to decrease water loss by transpiration D to increase water loss by transpiration 29 What occurs as carbohydrate is taken out of a sink into a phloem sieve tube element? water potential in phloem sieve tube element becomes volume of liquid in phloem sieve tube element A higher decreases B higher increases C lower decreases D lower increases 30 Which factors affect blood pressure? 1 the diameter of the blood vessels 2 the systolic pressure of the heart ventricles 3 the volume of blood returning to the heart in each cardiac cycle A 1, 2 and 3 B 1 and 3 only C 1 only D 2 and 3 only 31 Sulthiame is a molecule that inhibits carbonic anhydrase. Which effect would sulthiame have inside a red blood cell in muscle tissue that is respiring at a high rate? A a decrease in the rate of formation of haemoglobinic acid B a decrease in the pH C an increase in the rate of the chloride shift D an increase in the dissociation of oxyhaemoglobin

15 © UCLES 2023 9700/11/O/N/23 [Turn over 32 The partial pressure of oxygen in blood vessels in different parts of the body affects the percentage saturation of each haemoglobin molecule with oxygen. blood vessel partial pressure of oxygen / kPa saturation of each haemoglobin molecule with oxygen / % vein in active muscle 4 25 vein in resting muscle 7 75 arteriole in lungs 12 100 Which statement explains the difference in saturation between a resting and an active muscle? A A small decrease in partial pressure causes two atoms of oxygen to leave each haemoglobin molecule because the oxygen dissociation curve is sigmoid shaped. B A small decrease in partial pressure between 4 kPa and 7 kPa causes two molecules of oxygen to leave each haemoglobin molecule because the oxygen dissociation curve is steep. C Loading of oxygen is slower between 4 kPa and 7 kPa due to binding of one oxygen molecule to each haemoglobin molecule making the next one harder to bind. D Loading of oxygen is faster between 4 kPa and 7 kPa due to binding of one oxygen molecule to each haemoglobin molecule making the next one easier to bind. 33 Which statements about the Bohr shift are correct? 1 The shift is accelerated by the action of carbonic anhydrase. 2 A decrease in blood pH will cause oxyhaemoglobin to dissociate. 3 A decrease in carbon dioxide concentration will cause more oxygen to bind to haemoglobin. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

16 © UCLES 2023 9700/11/O/N/23 34 Some of the events during a cardiac cycle are listed. 1 Left and right atria contract. 2 Left and right ventricles contract. 3 A wave of electrical activity is conducted by the Purkyne tissue. 4 A wave of electrical activity passes through the atrioventricular node. What is the correct sequence of events after the sinoatrial node sends out a wave of electrical activity? A 1 → 3 → 4 → 2 B 1 → 4 → 3 → 2 C 2 → 4 → 3 → 1 D 4 → 1 → 3 → 2 35 Oxygen and carbon dioxide enter and leave the blood in the capillaries of the alveoli. Which statement about this process is correct? A Oxygen and carbon dioxide only pass through one cell layer to reach their destination. B Oxygen moves out of the blood and carbon dioxide moves into the blood during gaseous exchange. C Oxygen rapidly diffuses into the alveoli and carbon dioxide rapidly diffuses out of the alveoli due to the large surface area of the alveoli. D The capillaries have the lowest blood pressure in the body which allows the blood cells to remain in the alveolar capillaries to maximise gas exchange. 36 Which statement is correct? A Cholera is caused by the virus Vibrio cholerae. B Mosquitoes are pathogens that cause malaria. C Mycobacterium bovis only causes TB in humans. D Plasmodium vivax is an example of a protoctist.

17 © UCLES 2023 9700/11/O/N/23 [Turn over 37 The graph shows changes in the antibiotic resistance of a species of bacterium between 2000 and 2016 in one country. Samples of bacteria were collected every year from 48 hospitals. The bacteria were tested to see if they showed resistance to five different antibiotics. 100 75 50 25 0 tetracycline ciprofloxacin penicillin percentage of antibiotic resistant bacteria 2000 2002 2004 2006 2008 year 2010 2012 2014 2016 azithromycin cefixime key What can be concluded from the data in the graph? A Overuse of ciprofloxacin has caused antibiotic resistance to increase by more than 20% between 2000 and 2016. B Percentage resistance to three of the antibiotics was at a peak in 2015. C Changes in treatment guidelines have caused resistance to some antibiotics to decrease from 2015 to 2016. D The percentage of resistant bacteria is higher in 2016 than 2000 for all antibiotics. 38 Some responses made by cells of the immune system to a pathogen are listed. 1 mitosis 2 bind to specific antigens 3 produce memory cells 4 secrete antibodies Which responses are correct for B-lymphocytes? A 1, 2, 3 and 4 B 1, 2 and 4 only C 1 and 3 only D 2, 3 and 4 only

18 © UCLES 2023 9700/11/O/N/23 39 Which statements about uses of monoclonal antibodies are correct? 1 Monoclonal antibodies can be injected into patients to give active immunity. 2 Monoclonal antibodies can be injected into patients to treat viral infections. 3 Monoclonal antibodies can be used as diagnostic tests for specific pathogens. A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 3 only 40 Which statement explains how a vaccination programme can control the spread of an infectious disease in a population? A Unvaccinated individuals are less likely to meet a vaccinated individual. B Unvaccinated individuals are less likely to meet an infected individual. C Vaccinated individuals cannot catch the disease. D Vaccinated individuals have natural active immunity.

19 © UCLES 2023 9700/11/O/N/23 BLANK PAGE

20 Permission to reproduce items where third-party owned material protected by copyright is included has been sought and cleared where possible. Every reasonable effort has been made by the publisher (UCLES) to trace copyright holders, but if any items requiring clearance have unwittingly been included, the publisher will be pleased to make amends at the earliest possible opportunity. To avoid the issue of disclosure of answer-related information to candidates, all copyright acknowledgements are reproduced online in the Cambridge Assessment International Education Copyright Acknowledgements Booklet. This is produced for each series of examinations and is freely available to download at www.cambridgeinternational.org after the live examination series. Cambridge Assessment International Education is part of Cambridge Assessment. Cambridge Assessment is the brand name of the University of Cambridge Local Examinations Syndicate (UCLES), which is a department of the University of Cambridge. © UCLES 2023 9700/11/O/N/23 BLANK PAGE

This document consists of 3 printed pages. © UCLES 2023 [Turn over Cambridge International AS & A Level BIOLOGY 9700/11 Paper 1 Multiple Choice October/November 2023 MARK SCHEME Maximum Mark: 40 Published This mark scheme is published as an aid to teachers and candidates, to indicate the requirements of the examination. Mark schemes should be read in conjunction with the question paper and the Principal Examiner Report for Teachers. Cambridge International will not enter into discussions about these mark schemes. Cambridge International is publishing the mark schemes for the October/November 2023 series for most Cambridge IGCSE, Cambridge International A and AS Level components, and some Cambridge O Level components.

9700/11 Cambridge International AS & A Level – Mark Scheme PUBLISHED October/November 2023 © UCLES 2023 Page 2 of 3 Question Answer Marks 1 B 1 2 C 1 3 B 1 4 B 1 5 C 1 6 C 1 7 D 1 8 C 1 9 A 1 10 D 1 11 B 1 12 B 1 13 A 1 14 C 1 15 C 1 16 C 1 17 B 1 18 B 1 19 D 1 20 A 1 21 C 1 22 D 1 23 B 1 24 D 1 25 A 1 26 B 1 27 Question discounted 28 C 1

9700/11 Cambridge International AS & A Level – Mark Scheme PUBLISHED October/November 2023 © UCLES 2023 Page 3 of 3 Question Answer Marks 29 D 1 30 A 1 31 A 1 32 B 1 33 A 1 34 B 1 35 Question discounted 36 D 1 37 B 1 38 A 1 39 C 1 40 B 1